Transcript: Human XM_024449814.1

PREDICTED: Homo sapiens HHIP like 2 (HHIPL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHIPL2 (79802)
Length:
3039
CDS:
4..2235

Additional Resources:

NCBI RefSeq record:
XM_024449814.1
NBCI Gene record:
HHIPL2 (79802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256149 ATGTCCTGAGGAACGACTATC pLKO_005 551 CDS 100% 10.800 15.120 N HHIPL2 n/a
2 TRCN0000256148 CTCGGGCTGATCCTAACAAAG pLKO_005 938 CDS 100% 10.800 15.120 N HHIPL2 n/a
3 TRCN0000167823 GTTCTGCCAATCTATGCTTAT pLKO.1 1459 CDS 100% 10.800 15.120 N HHIPL2 n/a
4 TRCN0000168450 GAGCCACCTCATCAAATGAAA pLKO.1 2277 3UTR 100% 5.625 7.875 N HHIPL2 n/a
5 TRCN0000167585 GATCCGAATTAGTGAGATGAA pLKO.1 912 CDS 100% 4.950 6.930 N HHIPL2 n/a
6 TRCN0000256143 CAATCGCAAGTTCTATATTTA pLKO_005 858 CDS 100% 15.000 12.000 N HHIPL2 n/a
7 TRCN0000256144 ATCTTGCTGTCTACTGAATAA pLKO_005 2377 3UTR 100% 13.200 10.560 N HHIPL2 n/a
8 TRCN0000256147 ACTGGGACATCATGGAATATT pLKO_005 248 CDS 100% 15.000 10.500 N HHIPL2 n/a
9 TRCN0000256145 AGCTGTGTGGAGATTACATTA pLKO_005 287 CDS 100% 13.200 9.240 N HHIPL2 n/a
10 TRCN0000256141 TGGATGGCTATATGTACATAT pLKO_005 1040 CDS 100% 13.200 9.240 N HHIPL2 n/a
11 TRCN0000256146 AGTCAGTCACTGGAGGTTATG pLKO_005 1496 CDS 100% 10.800 7.560 N HHIPL2 n/a
12 TRCN0000256142 GAAGTCTCCCTTGACCTATTG pLKO_005 2222 CDS 100% 10.800 7.560 N HHIPL2 n/a
13 TRCN0000167270 CGTGGATCTATTTACAAGTTT pLKO.1 1774 CDS 100% 5.625 3.938 N HHIPL2 n/a
14 TRCN0000256140 TGCTGAATAAAGACCTTAGAA pLKO_005 2303 3UTR 100% 5.625 3.938 N HHIPL2 n/a
15 TRCN0000168877 CCAAATCTCAATGGCCTGTAT pLKO.1 1537 CDS 100% 4.950 3.465 N HHIPL2 n/a
16 TRCN0000195790 CCTGGGAAATCTTGCTGTCTA pLKO.1 2369 3UTR 100% 4.950 3.465 N Hhipl2 n/a
17 TRCN0000167503 GTATATCTTTGGAGACTTCAT pLKO.1 1554 CDS 100% 4.950 3.465 N HHIPL2 n/a
18 TRCN0000183274 GAAATCTTGCTGTCTACTGAA pLKO.1 2374 3UTR 100% 4.950 2.970 N Hhipl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12619 pDONR223 100% 71.1% 71.1% None 1_585del;1804_1860del n/a
2 ccsbBroad304_12619 pLX_304 0% 71.1% 71.1% V5 1_585del;1804_1860del n/a
3 TRCN0000465288 TCGGGGTTTTAGCGGAATGCCGCG pLX_317 22.8% 71.1% 71.1% V5 1_585del;1804_1860del n/a
4 ccsbBroadEn_15991 pDONR223 0% 34.4% 34.4% None 1_585del;1354_2229del n/a
5 ccsbBroad304_15991 pLX_304 0% 34.4% 34.4% V5 1_585del;1354_2229del n/a
6 TRCN0000473771 TACTACAGACAATTCTCGAACTGT pLX_317 71.7% 34.4% 34.4% V5 1_585del;1354_2229del n/a
Download CSV