Transcript: Human XM_024450102.1

PREDICTED: Homo sapiens solute carrier family 28 member 1 (SLC28A1), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC28A1 (9154)
Length:
2418
CDS:
1216..2253

Additional Resources:

NCBI RefSeq record:
XM_024450102.1
NBCI Gene record:
SLC28A1 (9154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445973 AGAGCGACTTCTCCCAGATAG pLKO_005 1859 CDS 100% 10.800 15.120 N SLC28A1 n/a
2 TRCN0000043568 GCAGCAGTAGCTTTGAGATTT pLKO.1 2000 CDS 100% 13.200 9.240 N SLC28A1 n/a
3 TRCN0000437000 TGTTCGTCGCTCTCCTCTTTG pLKO_005 628 5UTR 100% 10.800 7.560 N SLC28A1 n/a
4 TRCN0000043570 GATGCTCAGAACCTCATAGAA pLKO.1 1390 CDS 100% 5.625 3.938 N SLC28A1 n/a
5 TRCN0000043571 GCTGTGCTGGACTTTATCAAT pLKO.1 1483 CDS 100% 5.625 3.938 N SLC28A1 n/a
6 TRCN0000043569 CTCCTCGTCATCAGAACAGAA pLKO.1 723 5UTR 100% 4.950 3.465 N SLC28A1 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2399 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2400 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491748 ATTATGCAAACGGGTAGTGATCTT pLX_317 14.6% 40.9% 38.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07368 pDONR223 100% 40.8% 38.5% None (many diffs) n/a
3 ccsbBroad304_07368 pLX_304 0% 40.8% 38.5% V5 (many diffs) n/a
4 TRCN0000469767 GCTGGTTTTTTTGTTTTAACAGAT pLX_317 20.4% 40.8% 38.5% V5 (many diffs) n/a
5 TRCN0000488389 TAACTGTGGTCTTTGATTAAGTCC pLX_317 14.6% 40.8% 38.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV