Transcript: Human XM_024450151.1

PREDICTED: Homo sapiens chromodomain Y like 2 (CDYL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDYL2 (124359)
Length:
8201
CDS:
369..1712

Additional Resources:

NCBI RefSeq record:
XM_024450151.1
NBCI Gene record:
CDYL2 (124359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129793 CCATAAACGGAAGCGAATTAA pLKO.1 500 CDS 100% 15.000 21.000 N CDYL2 n/a
2 TRCN0000358995 ACGACCAATCTTAGGGAATTT pLKO_005 2142 3UTR 100% 13.200 18.480 N CDYL2 n/a
3 TRCN0000359010 CCCATAAACGGAAGCGAATTA pLKO_005 499 CDS 100% 13.200 18.480 N CDYL2 n/a
4 TRCN0000130929 CAAGAGGATCAAGTCAGGGAA pLKO.1 380 CDS 100% 2.640 3.696 N CDYL2 n/a
5 TRCN0000173551 GAATGAAAGCAACTGTCGGTT pLKO.1 917 CDS 100% 2.640 3.696 N Cdyl2 n/a
6 TRCN0000128562 GAGTATCTTATCCGATGGAAA pLKO.1 261 5UTR 100% 4.950 3.960 N CDYL2 n/a
7 TRCN0000359078 TGGATTATTCCTACCTAATTG pLKO_005 1123 CDS 100% 13.200 9.240 N CDYL2 n/a
8 TRCN0000359018 GTCCAGTCAGACCTCGGATAA pLKO_005 986 CDS 100% 10.800 7.560 N CDYL2 n/a
9 TRCN0000130741 GAGTTTGTCAAGGTGTCTCTT pLKO.1 1794 3UTR 100% 4.950 3.465 N CDYL2 n/a
10 TRCN0000129423 CGCCAGAATGAAAGCAACTGT pLKO.1 912 CDS 100% 3.000 2.100 N CDYL2 n/a
11 TRCN0000129278 CACTTTGGAAATGGGTCCCAT pLKO.1 696 CDS 100% 2.640 1.848 N CDYL2 n/a
12 TRCN0000130980 CCACTTGCTGAAATGCACCAT pLKO.1 1994 3UTR 100% 2.640 1.848 N CDYL2 n/a
13 TRCN0000130613 CTTAGGGAATTTCCAGACCAA pLKO.1 2151 3UTR 100% 2.640 1.848 N CDYL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04781 pDONR223 100% 88.3% 88.3% None 0_1ins177 n/a
2 ccsbBroad304_04781 pLX_304 0% 88.3% 88.3% V5 0_1ins177 n/a
3 TRCN0000476109 GCTGGTTGAAGATTCTCGGGCAGT pLX_317 22.5% 88.3% 88.3% V5 0_1ins177 n/a
Download CSV