Transcript: Human XM_024450612.1

PREDICTED: Homo sapiens period circadian regulator 3 (PER3), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PER3 (8863)
Length:
6680
CDS:
2386..5469

Additional Resources:

NCBI RefSeq record:
XM_024450612.1
NBCI Gene record:
PER3 (8863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275866 CCCTCGGAGAGACGCAATAAA pLKO_005 515 5UTR 100% 15.000 12.000 N PER3 n/a
2 TRCN0000018505 CGTGCCCACAAACTGAGTATT pLKO.1 4706 CDS 100% 13.200 9.240 N PER3 n/a
3 TRCN0000275865 ATGACCATGAAGTTATCATTG pLKO_005 5548 3UTR 100% 10.800 7.560 N PER3 n/a
4 TRCN0000275864 CGACAGCCTCTTCTGCGATAT pLKO_005 4481 CDS 100% 10.800 7.560 N PER3 n/a
5 TRCN0000018506 CCCATCCTATCAACAGATCAA pLKO.1 3456 CDS 100% 4.950 3.465 N PER3 n/a
6 TRCN0000018507 GCTAAGGTGTATAATTGGATT pLKO.1 5329 CDS 100% 4.950 3.465 N PER3 n/a
7 TRCN0000018504 GCTTCAGAACACACTTCCAAA pLKO.1 1814 5UTR 100% 4.950 3.465 N PER3 n/a
8 TRCN0000275924 GCTTCAGAACACACTTCCAAA pLKO_005 1814 5UTR 100% 4.950 3.465 N PER3 n/a
9 TRCN0000018503 CCCATGAAGAATCCATCCCAT pLKO.1 4849 CDS 100% 2.640 1.848 N PER3 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 998 5UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 999 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11314 pDONR223 100% 16.8% 16.8% None 0_1ins525;66_68delAGC;613_3081del n/a
2 ccsbBroad304_11314 pLX_304 0% 16.8% 16.8% V5 0_1ins525;66_68delAGC;613_3081del n/a
3 TRCN0000472289 CCACTCTCCTTCTGTGGGATATTC pLX_317 43% 16.8% 16.8% V5 0_1ins525;66_68delAGC;613_3081del n/a
Download CSV