Transcript: Human XM_024450775.1

PREDICTED: Homo sapiens leucine rich repeat containing 37 member A2 (LRRC37A2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC37A2 (474170)
Length:
2862
CDS:
4..2835

Additional Resources:

NCBI RefSeq record:
XM_024450775.1
NBCI Gene record:
LRRC37A2 (474170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265548 AGGTGAGGATCAAGCTTATTA pLKO_005 858 CDS 100% 15.000 7.500 Y LRRC37A2 n/a
2 TRCN0000254452 TCAATCTCCGGAACCTATTAA pLKO_005 1443 CDS 100% 15.000 7.500 Y LRRC37A2 n/a
3 TRCN0000265550 TTGGAATTACACGCCAATTAT pLKO_005 494 CDS 100% 15.000 7.500 Y LRRC37A2 n/a
4 TRCN0000254450 TCACCATCAAACTCATCATTT pLKO_005 1197 CDS 100% 13.200 6.600 Y LRRC37A2 n/a
5 TRCN0000121902 CCAGCGTTACAGTTCAACTTT pLKO.1 1814 CDS 100% 5.625 2.813 Y LRRC37A n/a
6 TRCN0000143055 CCCAAGAAGCTGAAGAAAGAT pLKO.1 442 CDS 100% 5.625 2.813 Y LRRC37A n/a
7 TRCN0000141309 CCAGGTCACCATCAAACTCAT pLKO.1 1192 CDS 100% 4.950 2.475 Y LRRC37A n/a
8 TRCN0000180259 CCTCCTATGGAGCATGAACTT pLKO.1 1048 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
9 TRCN0000144003 CCTTGCTGAGATTATTGGAAT pLKO.1 480 CDS 100% 4.950 2.475 Y LRRC37A n/a
10 TRCN0000142354 GCAGATGTGGAGGTTACCATA pLKO.1 907 CDS 100% 4.950 2.475 Y LRRC37A n/a
11 TRCN0000180805 GCGGAGATGAGATGTTGTCAT pLKO.1 2510 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
12 TRCN0000142010 GCTGGACCTTTAGCAGTTCAA pLKO.1 1408 CDS 100% 4.950 2.475 Y LRRC37A n/a
13 TRCN0000180204 CCATCATTCCAGAACCCACTA pLKO.1 2264 CDS 100% 4.050 2.025 Y LRRC37A3 n/a
14 TRCN0000180361 GCCACAGTTCAACCTTTGGAT pLKO.1 1627 CDS 100% 3.000 1.500 Y LRRC37A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13034 pDONR223 100% 41.3% 37.2% None (many diffs) n/a
2 ccsbBroad304_13034 pLX_304 0% 41.3% 37.2% V5 (many diffs) n/a
3 TRCN0000466676 ACGATCGTGATATACAATGGCACG pLX_317 15.7% 41.3% 37.2% V5 (many diffs) n/a
Download CSV