Transcript: Human XM_024450777.1

PREDICTED: Homo sapiens prolyl 4-hydroxylase subunit beta (P4HB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P4HB (5034)
Length:
2572
CDS:
65..1705

Additional Resources:

NCBI RefSeq record:
XM_024450777.1
NBCI Gene record:
P4HB (5034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296675 AGGTGAAATCAAGACTCACAT pLKO_005 814 CDS 100% 4.950 6.930 N P4HB n/a
2 TRCN0000049196 CGACAGGACGGTCATTGATTA pLKO.1 1542 CDS 100% 13.200 10.560 N P4HB n/a
3 TRCN0000310244 GCTCCCATTTGGGATAAACTG pLKO_005 1402 CDS 100% 4.950 3.960 N P4HB n/a
4 TRCN0000049194 GTGTGGTCACTGCAAACAGTT pLKO.1 1380 CDS 100% 4.950 3.960 N P4HB n/a
5 TRCN0000290651 GTGTGGTCACTGCAAACAGTT pLKO_005 1380 CDS 100% 4.950 3.960 N P4HB n/a
6 TRCN0000049197 TGACCAAGTACAAGCCCGAAT pLKO.1 1035 CDS 100% 4.050 3.240 N P4HB n/a
7 TRCN0000296736 TGCTGTTCTTGCCCAAGAGTG pLKO_005 837 CDS 100% 4.050 2.835 N P4HB n/a
8 TRCN0000049193 CGAGTTCTTTGGCCTGAAGAA pLKO.1 970 CDS 100% 0.495 0.347 N P4HB n/a
9 TRCN0000049195 CCAAGGAATATACAGCTGGCA pLKO.1 402 CDS 100% 0.660 0.396 N P4HB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01138 pDONR223 100% 91.4% 69.6% None 1178_1305del;1638_1639insTGAAAGATGAACTG n/a
2 ccsbBroad304_01138 pLX_304 20% 91.4% 69.6% V5 1178_1305del;1638_1639insTGAAAGATGAACTG n/a
3 TRCN0000468664 CCATCTATCAACAGGTAATGGCCA pLX_317 30.5% 91.4% 69.6% V5 1178_1305del;1638_1639insTGAAAGATGAACTG n/a
4 ccsbBroadEn_15517 pDONR223 0% 32.6% 14.2% None (many diffs) n/a
5 ccsbBroad304_15517 pLX_304 0% 32.6% 14.2% V5 (many diffs) n/a
6 TRCN0000491712 GCGTGGTCCATTCAGGTCCCAGTT pLX_317 64.1% 32.6% 14.2% V5 (many diffs) n/a
Download CSV