Transcript: Human XM_024450892.1

PREDICTED: Homo sapiens Sp2 transcription factor (SP2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SP2 (6668)
Length:
3048
CDS:
240..2060

Additional Resources:

NCBI RefSeq record:
XM_024450892.1
NBCI Gene record:
SP2 (6668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421266 GACGCGTGGGAACCCTTATTT pLKO_005 2329 3UTR 100% 15.000 21.000 N SP2 n/a
2 TRCN0000433492 ACCCGATCAAATGCCAATATC pLKO_005 588 CDS 100% 13.200 18.480 N SP2 n/a
3 TRCN0000020471 CGGCAAGAATAGCTTTGGAAT pLKO.1 455 CDS 100% 4.950 6.930 N SP2 n/a
4 TRCN0000424219 GCCCGTCAACAACCTTGTGAA pLKO_005 860 CDS 100% 4.950 6.930 N SP2 n/a
5 TRCN0000424089 ACGTTCCGTAAGACGTCCTTG pLKO_005 1821 CDS 100% 4.050 5.670 N SP2 n/a
6 TRCN0000433640 AGAAGCCCTCCCAGAACTTTC pLKO_005 1225 CDS 100% 10.800 7.560 N SP2 n/a
7 TRCN0000412285 TGGTGTTCGCTATCCAGAATC pLKO_005 547 CDS 100% 10.800 7.560 N SP2 n/a
8 TRCN0000432518 TGTCTAAGACTAACAAGAAAG pLKO_005 937 CDS 100% 10.800 7.560 N SP2 n/a
9 TRCN0000020473 GCAGAATGTTTCTGGGAACAA pLKO.1 1610 CDS 100% 4.950 3.465 N SP2 n/a
10 TRCN0000020472 GCAGGAAATAACCTGCTCATT pLKO.1 1056 CDS 100% 0.495 0.347 N SP2 n/a
11 TRCN0000433541 TCAGATTCAGGCAAGCAATTC pLKO_005 626 CDS 100% 10.800 6.480 N SP2 n/a
12 TRCN0000020469 CCCTTCTTCCTTTCCTTGTTA pLKO.1 2726 3UTR 100% 5.625 3.375 N SP2 n/a
13 TRCN0000304610 TGCCCAATGAGACGTTCTAAC pLKO_005 2304 3UTR 100% 10.800 7.560 N Sp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11151 pDONR223 100% 99% 99.1% None 586C>T;636T>C;1804_1818del n/a
2 ccsbBroad304_11151 pLX_304 0% 99% 99.1% V5 586C>T;636T>C;1804_1818del n/a
3 TRCN0000473389 CATTGGAGCGGCCCTTCAGACTAA pLX_317 24.4% 99% 99.1% V5 586C>T;636T>C;1804_1818del n/a
4 ccsbBroadEn_11150 pDONR223 100% 39.5% 38.2% None (many diffs) n/a
5 ccsbBroad304_11150 pLX_304 0% 39.5% 38.2% V5 (many diffs) n/a
6 TRCN0000465245 CACGAATGCACACACAACGACCCG pLX_317 42.6% 39.5% 38.2% V5 (many diffs) n/a
Download CSV