Transcript: Human XM_024450909.1

PREDICTED: Homo sapiens zinc finger protein 18 (ZNF18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF18 (7566)
Length:
4188
CDS:
533..2182

Additional Resources:

NCBI RefSeq record:
XM_024450909.1
NBCI Gene record:
ZNF18 (7566)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018079 CCCAAATCTGACCTGACTAAT pLKO.1 1298 CDS 100% 13.200 10.560 N ZNF18 n/a
2 TRCN0000230121 ATGACAAGGAGAACCTAAATT pLKO_005 1410 CDS 100% 15.000 10.500 N ZNF18 n/a
3 TRCN0000230120 CAAATCTGACCTGACTAATTC pLKO_005 1300 CDS 100% 13.200 9.240 N ZNF18 n/a
4 TRCN0000230122 ACACCGGAGAGACATACTTTC pLKO_005 1821 CDS 100% 10.800 7.560 N ZNF18 n/a
5 TRCN0000230119 CTGTGGCAATGGATCAGTATC pLKO_005 908 CDS 100% 10.800 7.560 N ZNF18 n/a
6 TRCN0000219038 TTAGCTGTAGTCACTGCTTAT pLKO_005 2505 3UTR 100% 10.800 7.560 N ZNF18 n/a
7 TRCN0000018078 GCCTTGACAAACATCAAAGAT pLKO.1 2133 CDS 100% 5.625 3.938 N ZNF18 n/a
8 TRCN0000018081 CATAGGAGATAGACAAGAGAA pLKO.1 1390 CDS 100% 4.950 3.465 N ZNF18 n/a
9 TRCN0000018080 GCAGATCCTAGAGATCCTCAT pLKO.1 766 CDS 100% 4.050 2.835 N ZNF18 n/a
10 TRCN0000018082 CACTTAGGAAAGAAGCCCTTT pLKO.1 2156 CDS 100% 4.050 2.430 N ZNF18 n/a
11 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 1991 CDS 100% 15.000 7.500 Y LOC66376 n/a
12 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 1991 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
13 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2075 CDS 100% 15.000 7.500 Y Gm10771 n/a
14 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2075 CDS 100% 15.000 7.500 Y ZNF286B n/a
15 TRCN0000243738 CAGGAGAGAAACCCTATAAAT pLKO_005 1992 CDS 100% 15.000 7.500 Y Gm14430 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07151 pDONR223 100% 99.8% 99.6% None 629A>G;720G>C n/a
2 ccsbBroad304_07151 pLX_304 0% 99.8% 99.6% V5 629A>G;720G>C n/a
3 TRCN0000491886 TGCGAATCCTCAAAGTTTCCCCTT pLX_317 23.7% 99.8% 99.6% V5 629A>G;720G>C n/a
Download CSV