Transcript: Human XM_024450962.1

PREDICTED: Homo sapiens dynein regulatory complex subunit 3 (DRC3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DRC3 (83450)
Length:
2323
CDS:
447..2135

Additional Resources:

NCBI RefSeq record:
XM_024450962.1
NBCI Gene record:
DRC3 (83450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139823 CCACCTCCTGAAGATTGACAA pLKO.1 1943 CDS 100% 4.950 6.930 N DRC3 n/a
2 TRCN0000141567 CCGGATTGACAACATGATGAA pLKO.1 929 CDS 100% 4.950 6.930 N DRC3 n/a
3 TRCN0000142292 GACATCAGTGAGTTGTTCGAT pLKO.1 1632 CDS 100% 3.000 4.200 N DRC3 n/a
4 TRCN0000142463 GTTGACATGGTAGGACTGTTT pLKO.1 1725 CDS 100% 4.950 3.960 N DRC3 n/a
5 TRCN0000144545 CAAACGCAAGATTGCCAAATT pLKO.1 1523 CDS 100% 13.200 9.240 N DRC3 n/a
6 TRCN0000139158 CCTAGAATGCAGTGCTGACAT pLKO.1 1616 CDS 100% 4.950 3.465 N DRC3 n/a
7 TRCN0000139159 CCTCTGGCAGTTTGAGAACTT pLKO.1 686 CDS 100% 4.950 3.465 N DRC3 n/a
8 TRCN0000142656 GCAGCTGGACAATAACATCAT pLKO.1 716 CDS 100% 4.950 3.465 N DRC3 n/a
9 TRCN0000140452 GATGGACGATGACATGCTCAA pLKO.1 482 CDS 100% 4.050 2.835 N DRC3 n/a
10 TRCN0000141411 CCTGAAGATTGACAATCGAGA pLKO.1 1949 CDS 100% 2.640 1.848 N DRC3 n/a
11 TRCN0000140486 GAGCTTGTTCAACAACCGGAT pLKO.1 848 CDS 100% 2.160 1.512 N DRC3 n/a
12 TRCN0000140168 GAGTTGGAACTGCCCAACATT pLKO.1 1584 CDS 100% 0.563 0.394 N DRC3 n/a
13 TRCN0000139854 CCTTGAGACCTACAAGGACAA pLKO.1 1379 CDS 100% 0.405 0.284 N DRC3 n/a
14 TRCN0000144314 CAAGGACAAGTTTGTCATCAT pLKO.1 1391 CDS 100% 4.950 2.970 N DRC3 n/a
15 TRCN0000144638 GAAGGAGATCAATCAGTACAT pLKO.1 2060 CDS 100% 4.950 2.970 N DRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04268 pDONR223 100% 93% 92.8% None 161_220del;652_708del n/a
2 ccsbBroad304_04268 pLX_304 0% 93% 92.8% V5 161_220del;652_708del n/a
3 TRCN0000469826 TTGTTGCAAGTTCTTCCCAACTCA pLX_317 30% 93% 92.8% V5 161_220del;652_708del n/a
4 ccsbBroadEn_16018 pDONR223 0% 92.9% 92.7% None (many diffs) n/a
5 ccsbBroad304_16018 pLX_304 0% 92.9% 92.7% V5 (many diffs) n/a
6 TRCN0000470097 ACGGGGGTTCCTAGATATATGTCT pLX_317 32.3% 75.9% 59.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV