Transcript: Human XM_024451232.1

PREDICTED: Homo sapiens RAB27B, member RAS oncogene family (RAB27B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB27B (5874)
Length:
9386
CDS:
2627..3283

Additional Resources:

NCBI RefSeq record:
XM_024451232.1
NBCI Gene record:
RAB27B (5874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293979 GACGCCATGGGCTTCTTATTA pLKO_005 2897 CDS 100% 15.000 21.000 N RAB27B n/a
2 TRCN0000047688 CCCAAATTCATCACTACAGTA pLKO.1 2732 CDS 100% 4.950 6.930 N RAB27B n/a
3 TRCN0000382413 TCGGGAACTGGCTGACAAATA pLKO_005 3070 CDS 100% 13.200 10.560 N RAB27B n/a
4 TRCN0000047690 CTGACAAATATGGCATACCAT pLKO.1 3081 CDS 100% 3.000 2.400 N RAB27B n/a
5 TRCN0000380112 ACACAATTGTTGTTGAGTAAA pLKO_005 3350 3UTR 100% 13.200 9.240 N RAB27B n/a
6 TRCN0000294016 CATCATCATGGATACTCAATT pLKO_005 3510 3UTR 100% 13.200 9.240 N RAB27B n/a
7 TRCN0000293978 CCAGTCAACAGAGCTTCTTAA pLKO_005 2931 CDS 100% 13.200 9.240 N RAB27B n/a
8 TRCN0000380904 CAGATCAGAGGGAAGTCAATG pLKO_005 3039 CDS 100% 10.800 7.560 N RAB27B n/a
9 TRCN0000047689 GATACTGTCAATGGTGGAAAT pLKO.1 3212 CDS 100% 10.800 7.560 N RAB27B n/a
10 TRCN0000286657 GATACTGTCAATGGTGGAAAT pLKO_005 3212 CDS 100% 10.800 7.560 N RAB27B n/a
11 TRCN0000047691 GCCAACTGCAAGCAAATGCTT pLKO.1 2970 CDS 100% 3.000 2.100 N RAB27B n/a
12 TRCN0000286658 GCCAACTGCAAGCAAATGCTT pLKO_005 2970 CDS 100% 3.000 2.100 N RAB27B n/a
13 TRCN0000047692 GTAGGAATAGACTTTCGGGAA pLKO.1 2750 CDS 100% 2.160 1.512 N RAB27B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01362 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01362 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470827 GAGCAAGATAAGCATAAGCAACTA pLX_317 59.4% 100% 100% V5 n/a
Download CSV