Transcript: Human XM_024452037.1

PREDICTED: Homo sapiens U2 small nuclear RNA auxiliary factor 1 like 5 (U2AF1L5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
U2AF1L5 (102724594)
Length:
1720
CDS:
1071..1574

Additional Resources:

NCBI RefSeq record:
XM_024452037.1
NBCI Gene record:
U2AF1L5 (102724594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239505 CCATTGCCCTCTTGAACATTT pLKO_005 985 5UTR 100% 13.200 6.600 Y LOC441722 n/a
2 TRCN0000315163 TGAATAACCGTTGGTTTAATG pLKO_005 1240 CDS 100% 13.200 6.600 Y U2AF1 n/a
3 TRCN0000001158 GAGATGCAGGAACACTATGAT pLKO.1 1068 5UTR 100% 5.625 2.813 Y U2AF1 n/a
4 TRCN0000350417 GAGATGCAGGAACACTATGAT pLKO_005 1068 5UTR 100% 5.625 2.813 Y U2AF1 n/a
5 TRCN0000001156 CCGACGTTTAGCCAGACCATT pLKO.1 969 5UTR 100% 4.950 2.475 Y U2AF1 n/a
6 TRCN0000315228 CCGACGTTTAGCCAGACCATT pLKO_005 969 5UTR 100% 4.950 2.475 Y U2AF1 n/a
7 TRCN0000001157 CGTCGCAAGAAGCATAGATCA pLKO.1 1416 CDS 100% 4.950 2.475 Y U2AF1 n/a
8 TRCN0000001155 GAAAGTGTTGTAGTTGATTGA pLKO.1 1604 3UTR 100% 4.950 2.475 Y U2AF1 n/a
9 TRCN0000315162 GAAAGTGTTGTAGTTGATTGA pLKO_005 1604 3UTR 100% 4.950 2.475 Y U2AF1 n/a
10 TRCN0000123549 CCTCTTGAACATTTACCGTAA pLKO.1 992 5UTR 100% 4.050 2.025 Y U2af1 n/a
11 TRCN0000123552 GCCCTCTTGAACATTTACCGT pLKO.1 990 5UTR 100% 0.750 0.375 Y U2af1 n/a
12 TRCN0000332111 GCCCTCTTGAACATTTACCGT pLKO_005 990 5UTR 100% 0.750 0.375 Y U2af1 n/a
13 TRCN0000001159 GTTGGTTTAATGGACAGCCGA pLKO.1 1249 CDS 100% 0.660 0.330 Y U2AF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07113 pDONR223 100% 99.8% 99.4% None 61G>A n/a
2 ccsbBroad304_07113 pLX_304 0% 99.8% 99.4% V5 61G>A n/a
3 TRCN0000473733 CTCTCTAGGATTCGCGCTCTAATC pLX_317 73.3% 99.8% 99.4% V5 61G>A n/a
4 ccsbBroadEn_01731 pDONR223 100% 69.5% 69.5% None 0_1ins219 n/a
5 ccsbBroad304_01731 pLX_304 0% 69.5% 69.5% V5 0_1ins219 n/a
6 TRCN0000471281 CGCTGTTGAGCGTCCCGGAGAGTC pLX_317 53.9% 69.5% 69.5% V5 0_1ins219 n/a
Download CSV