Transcript: Human XM_024452117.1

PREDICTED: Homo sapiens poly(rC) binding protein 3 (PCBP3), transcript variant X41, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCBP3 (54039)
Length:
2340
CDS:
573..1592

Additional Resources:

NCBI RefSeq record:
XM_024452117.1
NBCI Gene record:
PCBP3 (54039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074701 TGATCTAATAGGCTGCATAAT pLKO.1 1382 CDS 100% 13.200 18.480 N PCBP3 n/a
2 TRCN0000425115 CTTTACACTCCTCCGAAGAAG pLKO_005 1285 CDS 100% 4.950 6.930 N PCBP3 n/a
3 TRCN0000074702 CAATGATCTAATAGGCTGCAT pLKO.1 1379 CDS 100% 2.640 3.696 N PCBP3 n/a
4 TRCN0000074698 CCTGCCTCACAGATACCAATA pLKO.1 1676 3UTR 100% 10.800 7.560 N PCBP3 n/a
5 TRCN0000439892 GCACTCATGAGCTCACCATTC pLKO_005 1357 CDS 100% 6.000 4.200 N PCBP3 n/a
6 TRCN0000074699 GCATACAAGTTTGAGGAGGAT pLKO.1 798 CDS 100% 2.640 1.848 N PCBP3 n/a
7 TRCN0000074700 CCTTGCCCAGTATCTCATCAA pLKO.1 1529 CDS 100% 4.950 2.970 N PCBP3 n/a
8 TRCN0000120935 CCCAGTATCTCATCAACGCTA pLKO.1 1534 CDS 100% 2.640 1.848 N Pcbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12028 pDONR223 100% 92.2% 92.3% None 327T>C;503_577del;622_624delCAG n/a
2 ccsbBroad304_12028 pLX_304 0% 92.2% 92.3% V5 327T>C;503_577del;622_624delCAG n/a
3 TRCN0000469904 ATGCCGTTAATTACTGGTAATACC pLX_317 37.5% 92.2% 92.3% V5 327T>C;503_577del;622_624delCAG n/a
4 ccsbBroadEn_12029 pDONR223 100% 92.2% 92.3% None 327T>C;503_577del;622_624delCAG n/a
5 ccsbBroad304_12029 pLX_304 0% 92.2% 92.3% V5 327T>C;503_577del;622_624delCAG n/a
6 TRCN0000479702 AGCGCCTTGAATTGTTTCTCACCC pLX_317 31.8% 92.2% 92.3% V5 327T>C;503_577del;622_624delCAG n/a
Download CSV