Transcript: Human XM_024452218.1

PREDICTED: Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3C (APOBEC3C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOBEC3C (27350)
Length:
2888
CDS:
128..811

Additional Resources:

NCBI RefSeq record:
XM_024452218.1
NBCI Gene record:
APOBEC3C (27350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052101 GCACATTCTACTTCCAATTTA pLKO.1 171 CDS 100% 15.000 10.500 N APOBEC3C n/a
2 TRCN0000299627 GCACATTCTACTTCCAATTTA pLKO_005 171 CDS 100% 15.000 10.500 N APOBEC3C n/a
3 TRCN0000052099 CGCCTCTACTACTTCCAGTAT pLKO.1 491 CDS 100% 4.950 3.465 N APOBEC3C n/a
4 TRCN0000299626 CGCCTCTACTACTTCCAGTAT pLKO_005 491 CDS 100% 4.950 3.465 N APOBEC3C n/a
5 TRCN0000052102 CGCTGTGGAGATCATGGACTA pLKO.1 556 CDS 100% 4.050 2.835 N APOBEC3C n/a
6 TRCN0000299560 CGCTGTGGAGATCATGGACTA pLKO_005 556 CDS 100% 4.050 2.835 N APOBEC3C n/a
7 TRCN0000052098 CCAGGCACATTCTACTTCCAA pLKO.1 167 CDS 100% 3.000 2.100 N APOBEC3C n/a
8 TRCN0000052100 ACCAACTTTCGACTTCTGAAA pLKO.1 876 3UTR 100% 4.950 2.475 Y APOBEC3C n/a
9 TRCN0000299628 ACCAACTTTCGACTTCTGAAA pLKO_005 876 3UTR 100% 4.950 2.475 Y APOBEC3C n/a
10 TRCN0000155111 GATCATGGACTATGAAGGTGA pLKO.1 565 CDS 100% 2.640 1.320 Y APOBEC3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08087 pDONR223 100% 72% 61.8% None (many diffs) n/a
2 ccsbBroad304_08087 pLX_304 0% 72% 61.8% V5 (many diffs) n/a
3 TRCN0000480993 GATCGGGACTTACTATGTTTATTC pLX_317 71.3% 72% 61.8% V5 (many diffs) n/a
4 ccsbBroadEn_09588 pDONR223 100% 34% 26% None (many diffs) n/a
5 ccsbBroad304_09588 pLX_304 0% 34% 26% V5 (many diffs) n/a
6 TRCN0000466607 ACTCGATAAAACTAGGGCTATTAC pLX_317 33.8% 34% 26% V5 (many diffs) n/a
Download CSV