Transcript: Human XM_024452238.1

PREDICTED: Homo sapiens chromosome 22 open reading frame 34 (C22orf34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C22orf34 (348645)
Length:
19010
CDS:
4434..5405

Additional Resources:

NCBI RefSeq record:
XM_024452238.1
NBCI Gene record:
C22orf34 (348645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146805 CGTGACAATGCATTTGATTCA pLKO.1 5333 CDS 100% 4.950 3.960 N C22orf34 n/a
2 TRCN0000148417 CAATACAGATGTGGCAGGTTT pLKO.1 4991 CDS 100% 4.950 3.465 N C22orf34 n/a
3 TRCN0000148869 CACTGTCTCTATGTCTGTCTT pLKO.1 5368 CDS 100% 4.950 3.465 N C22orf34 n/a
4 TRCN0000149153 GTCTGTCTTTATCTCACTGTG pLKO.1 5380 CDS 100% 4.050 2.430 N C22orf34 n/a
5 TRCN0000147028 CCAGACACAGAAAGACAAATA pLKO.1 8053 3UTR 100% 13.200 6.600 Y C22orf34 n/a
6 TRCN0000149311 GCCAGACACAGAAAGACAAAT pLKO.1 8052 3UTR 100% 13.200 6.600 Y C22orf34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13620 pDONR223 100% 27.1% 16.5% None (many diffs) n/a
2 ccsbBroad304_13620 pLX_304 0% 27.1% 16.5% V5 (many diffs) n/a
3 TRCN0000491606 AAGACATGTAACTTTTGGGATGCA pLX_317 100% 11.4% 10.8% V5 (many diffs) n/a
Download CSV