Transcript: Human XM_024452346.1

PREDICTED: Homo sapiens family with sequence similarity 9 member B (FAM9B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM9B (171483)
Length:
1195
CDS:
299..859

Additional Resources:

NCBI RefSeq record:
XM_024452346.1
NBCI Gene record:
FAM9B (171483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141689 CGTGACCAATTCGTAAAGGCT pLKO.1 773 CDS 100% 0.750 1.050 N FAM9B n/a
2 TRCN0000416395 ACATTCTCTGAAGTTGCTAAA pLKO_005 598 CDS 100% 10.800 7.560 N FAM9B n/a
3 TRCN0000435996 GAACTTGATAACTAGACATGT pLKO_005 845 CDS 100% 4.950 3.465 N FAM9B n/a
4 TRCN0000143725 GAAGACCTTTGTGACAGAGTT pLKO.1 806 CDS 100% 4.950 3.465 N FAM9B n/a
5 TRCN0000142699 CCAGAAGATACTGCAGAGGAT pLKO.1 464 CDS 100% 2.640 1.848 N FAM9B n/a
6 TRCN0000144222 CAGAAGAAGTGGCAACAATAT pLKO.1 710 CDS 100% 13.200 7.920 N FAM9B n/a
7 TRCN0000145402 GATGAAGACAGTGAACTTGAT pLKO.1 833 CDS 100% 4.950 2.970 N FAM9B n/a
8 TRCN0000429878 ACTCGTCTGTTAAATGCCAGA pLKO_005 1060 3UTR 100% 2.160 1.296 N FAM9B n/a
9 TRCN0000145266 GTGATGAATGTGAGGAAAGAA pLKO.1 342 CDS 100% 5.625 2.813 Y FAM9B n/a
10 TRCN0000142909 CGTGATGAATGTGAGGAAAGA pLKO.1 341 CDS 100% 4.950 2.475 Y FAM9B n/a
11 TRCN0000141788 GAAGAGGGAGAAGAGGAAGAA pLKO.1 665 CDS 100% 4.950 2.475 Y FAM9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05164 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05164 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467389 CAGTCTCATTCTCTGGCACTACGG pLX_317 75.9% 100% 100% V5 n/a
Download CSV