Transcript: Human XM_024452534.1

PREDICTED: Homo sapiens STAM binding protein (STAMBP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAMBP (10617)
Length:
1784
CDS:
234..1061

Additional Resources:

NCBI RefSeq record:
XM_024452534.1
NBCI Gene record:
STAMBP (10617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073973 GCAATATGAATGGAGCTTATT pLKO.1 1624 3UTR 100% 13.200 9.240 N STAMBP n/a
2 TRCN0000299500 GCAATATGAATGGAGCTTATT pLKO_005 1624 3UTR 100% 13.200 9.240 N STAMBP n/a
3 TRCN0000073975 CCAGAGTCAGTAGCCATTGTT pLKO.1 906 CDS 100% 5.625 3.938 N STAMBP n/a
4 TRCN0000331661 CCAGAGTCAGTAGCCATTGTT pLKO_005 906 CDS 100% 5.625 3.938 N STAMBP n/a
5 TRCN0000073977 CACAACTGTAAGGCCAGCTAA pLKO.1 494 CDS 100% 4.950 3.465 N STAMBP n/a
6 TRCN0000299499 CACAACTGTAAGGCCAGCTAA pLKO_005 494 CDS 100% 4.950 3.465 N STAMBP n/a
7 TRCN0000073976 TCCAGGAAACTGGATTCTTTA pLKO.1 940 CDS 100% 1.320 0.924 N STAMBP n/a
8 TRCN0000299424 TCCAGGAAACTGGATTCTTTA pLKO_005 940 CDS 100% 1.320 0.924 N STAMBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02485 pDONR223 100% 64% 63.9% None (many diffs) n/a
2 ccsbBroad304_02485 pLX_304 0% 64% 63.9% V5 (many diffs) n/a
3 TRCN0000469931 CCACCAGGTGAAGGTCTGTTTTTA pLX_317 29.5% 64% 63.9% V5 (many diffs) n/a
4 ccsbBroadEn_07652 pDONR223 100% 64% 63.9% None (many diffs) n/a
5 ccsbBroad304_07652 pLX_304 0% 64% 63.9% V5 (many diffs) n/a
6 TRCN0000480622 TGTAAGAACCATGTTGCCGACTGG pLX_317 29.7% 64% 63.9% V5 (many diffs) n/a
Download CSV