Transcript: Human XM_024452789.1

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 18 (PTPN18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN18 (26469)
Length:
2118
CDS:
75..1394

Additional Resources:

NCBI RefSeq record:
XM_024452789.1
NBCI Gene record:
PTPN18 (26469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381001 TGATGGCCTGTCGAGAGATAG pLKO_005 457 CDS 100% 10.800 15.120 N PTPN18 n/a
2 TRCN0000381010 GTCCTGTGCACCGTGGATTAT pLKO_005 786 CDS 100% 13.200 10.560 N PTPN18 n/a
3 TRCN0000380807 AGGACCCTCAAGGTCACATTC pLKO_005 594 CDS 100% 10.800 7.560 N PTPN18 n/a
4 TRCN0000382258 CTCTTTGATGTGGTCCTTAAG pLKO_005 852 CDS 100% 10.800 7.560 N PTPN18 n/a
5 TRCN0000380069 TAAAGGAGAAGTGGCTGAATG pLKO_005 559 CDS 100% 10.800 7.560 N PTPN18 n/a
6 TRCN0000003045 GCCTGTCGAGAGATAGAGAAT pLKO.1 462 CDS 100% 4.950 3.465 N PTPN18 n/a
7 TRCN0000003044 GAGATAGAGAATGGGCGGAAA pLKO.1 471 CDS 100% 4.050 2.835 N PTPN18 n/a
8 TRCN0000003046 ACCAGAACATCAAAGAGAATT pLKO.1 982 CDS 100% 0.000 0.000 N PTPN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11826 pDONR223 100% 70.2% 70.2% None (many diffs) n/a
2 ccsbBroad304_11826 pLX_304 0% 70.2% 70.2% V5 (many diffs) n/a
3 TRCN0000472726 CCCACCGGGGCCGAACTTAGATCC pLX_317 21.1% 70.2% 70.2% V5 (many diffs) n/a
4 TRCN0000491725 TCATACATTCGTGTCTCGCGCAGC pLX_317 30.4% 70.2% 70.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV