Transcript: Human XM_024452899.1

PREDICTED: Homo sapiens microtubule associated protein 2 (MAP2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2 (4133)
Length:
9734
CDS:
452..6013

Additional Resources:

NCBI RefSeq record:
XM_024452899.1
NBCI Gene record:
MAP2 (4133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413564 GACCGAACCATCTGCATTAAT pLKO_005 1999 CDS 100% 15.000 21.000 N MAP2 n/a
2 TRCN0000427297 CAAAGTCTCTGACGGAGTAAC pLKO_005 5011 CDS 100% 10.800 15.120 N MAP2 n/a
3 TRCN0000108235 CCCAAACTGTAGTAATTGTTA pLKO.1 6129 3UTR 100% 5.625 7.875 N MAP2 n/a
4 TRCN0000108237 CCGATATTCTAACCAACACTA pLKO.1 2622 CDS 100% 4.950 6.930 N MAP2 n/a
5 TRCN0000108239 CCACCTGAGATTAAGGATCAA pLKO.1 533 CDS 100% 4.950 3.960 N MAP2 n/a
6 TRCN0000420891 TTACGAAGGCACTGATGATAA pLKO_005 3124 CDS 100% 13.200 9.240 N MAP2 n/a
7 TRCN0000108236 CGTCAAATTGTCAGTGGAAAT pLKO.1 3934 CDS 100% 10.800 7.560 N MAP2 n/a
8 TRCN0000108238 CCGTCAAATTGTCAGTGGAAA pLKO.1 3933 CDS 100% 4.950 3.465 N MAP2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9077 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000072066 CTCAACATAAAGACCAGACAA pLKO.1 792 CDS 100% 4.950 3.465 N Rbmy n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06559 pDONR223 100% 29.8% 27.8% None (many diffs) n/a
2 ccsbBroad304_06559 pLX_304 0% 29.8% 27.8% V5 (many diffs) n/a
3 TRCN0000478641 CGCTTCTGCGATGCTCAGGACAGG pLX_317 23% 29.8% 27.8% V5 (many diffs) n/a
Download CSV