Transcript: Human XM_024452984.1

PREDICTED: Homo sapiens LIM zinc finger domain containing 2 (LIMS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIMS2 (55679)
Length:
2140
CDS:
270..1280

Additional Resources:

NCBI RefSeq record:
XM_024452984.1
NBCI Gene record:
LIMS2 (55679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257031 CTCCAGGGACAGGAGCAAATT pLKO_005 1566 3UTR 100% 13.200 9.240 N LIMS2 n/a
2 TRCN0000257025 ACAACTGCAGCCATGTGATTG pLKO_005 1027 CDS 100% 10.800 7.560 N LIMS2 n/a
3 TRCN0000244782 CCTGCGGTGAGTTCATCATTG pLKO_005 487 CDS 100% 10.800 7.560 N LIMS2 n/a
4 TRCN0000244780 CTGCGAACACGACTTCCAAAT pLKO_005 443 CDS 100% 10.800 7.560 N LIMS2 n/a
5 TRCN0000244781 TCACCCTGAAGAACAAGTTTG pLKO_005 1123 CDS 100% 10.800 7.560 N LIMS2 n/a
6 TRCN0000180591 CCTCCCTTTCTCTTTCCTCAT pLKO.1 1384 3UTR 100% 4.050 2.835 N LIMS2 n/a
7 TRCN0000147626 GAAGAACAAGTTTGTGGAGTT pLKO.1 1130 CDS 100% 4.050 2.835 N LIMS2 n/a
8 TRCN0000112647 CCCGTGTGTAAGAGGTGCTAT pLKO.1 1161 CDS 100% 4.950 3.960 N Lims2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12250 pDONR223 100% 12.2% 12.2% None 1_885del n/a
2 ccsbBroad304_12250 pLX_304 0% 12.2% 12.2% V5 1_885del n/a
3 TRCN0000480198 CAGTAAACTCCATAGGACTTAACC pLX_317 100% 12.2% 12.2% V5 1_885del n/a
Download CSV