Transcript: Human XM_024453015.1

PREDICTED: Homo sapiens SSX family member 2 interacting protein (SSX2IP), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSX2IP (117178)
Length:
5011
CDS:
214..2055

Additional Resources:

NCBI RefSeq record:
XM_024453015.1
NBCI Gene record:
SSX2IP (117178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151063 GTTCCTGCATATCTGAACATA pLKO.1 1859 CDS 100% 5.625 7.875 N SSX2IP n/a
2 TRCN0000153872 CGTTCCTGCATATCTGAACAT pLKO.1 1858 CDS 100% 4.950 6.930 N SSX2IP n/a
3 TRCN0000415338 ATAGTACAGGAACTGTTATTT pLKO_005 1127 CDS 100% 15.000 10.500 N SSX2IP n/a
4 TRCN0000419828 ATGATACCACTTCACTATTAC pLKO_005 1451 CDS 100% 13.200 9.240 N SSX2IP n/a
5 TRCN0000429747 ATTGAACAGAGTATCTCATAT pLKO_005 397 CDS 100% 13.200 9.240 N SSX2IP n/a
6 TRCN0000150783 GCAGTCTATGATGAGAAACAA pLKO.1 4529 3UTR 100% 5.625 3.938 N SSX2IP n/a
7 TRCN0000157988 CCAGACTCATTGCACCTTCAA pLKO.1 4091 3UTR 100% 4.950 3.465 N SSX2IP n/a
8 TRCN0000150627 GAACGTCTACATCAACTTGTT pLKO.1 841 CDS 100% 4.950 3.465 N SSX2IP n/a
9 TRCN0000156615 GAGAGAGTATGTGGGACCTTT pLKO.1 1181 CDS 100% 4.950 3.465 N SSX2IP n/a
10 TRCN0000156312 CCAAATCAGGTTGGAGGAGAA pLKO.1 1921 CDS 100% 4.050 2.835 N SSX2IP n/a
11 TRCN0000154301 GAAATGATTGGGCTTCAGGAA pLKO.1 664 CDS 100% 2.640 1.848 N SSX2IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09444 pDONR223 100% 99.6% 99.1% None (many diffs) n/a
2 ccsbBroad304_09444 pLX_304 0% 99.6% 99.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474311 CCTGCGAGCGAGTGCTCAGTGCGT pLX_317 21.6% 99.6% 99.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13063 pDONR223 100% 91% 90.7% None (many diffs) n/a
5 ccsbBroad304_13063 pLX_304 0% 91% 90.7% V5 (many diffs) n/a
6 TRCN0000475421 GAGCAAGCGCGCCTGATCAGTACT pLX_317 28.9% 91% 90.7% V5 (many diffs) n/a
Download CSV