Transcript: Human XM_024453138.1

PREDICTED: Homo sapiens galactosidase beta 1 like (GLB1L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLB1L (79411)
Length:
2743
CDS:
583..2277

Additional Resources:

NCBI RefSeq record:
XM_024453138.1
NBCI Gene record:
GLB1L (79411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370163 ATGTTGTACCGAACCTATATG pLKO_005 1552 CDS 100% 13.200 10.560 N GLB1L n/a
2 TRCN0000155788 CTTCCGATTACTACCAGCTAT pLKO.1 1279 CDS 100% 4.950 3.465 N GLB1L n/a
3 TRCN0000154750 GCCATTGGTAAACTCTGAGTA pLKO.1 1086 CDS 100% 4.950 3.465 N GLB1L n/a
4 TRCN0000353783 GCCATTGGTAAACTCTGAGTA pLKO_005 1086 CDS 100% 4.950 3.465 N GLB1L n/a
5 TRCN0000156803 GTGGATGATGTTCCCTCTGAA pLKO.1 1830 CDS 100% 4.950 3.465 N GLB1L n/a
6 TRCN0000331009 GTGGATGATGTTCCCTCTGAA pLKO_005 1830 CDS 100% 4.950 3.465 N GLB1L n/a
7 TRCN0000157496 GATTACCTGAGGTCAGGACTT pLKO.1 2342 3UTR 100% 4.050 2.430 N GLB1L n/a
8 TRCN0000353784 GATTACCTGAGGTCAGGACTT pLKO_005 2342 3UTR 100% 4.050 2.430 N GLB1L n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2470 3UTR 100% 10.800 5.400 Y SMIM11A n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 252 5UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 286 5UTR 100% 1.080 0.540 Y GPR83 n/a
12 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 286 5UTR 100% 1.080 0.540 Y MYORG n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2304 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12565 pDONR223 98.8% 72.8% 72.8% None 1_459del n/a
2 ccsbBroad304_12565 pLX_304 0% 72.8% 72.8% V5 (not translated due to prior stop codon) 1_459del n/a
Download CSV