Transcript: Human XM_024453308.1

PREDICTED: Homo sapiens ariadne RBR E3 ubiquitin protein ligase 2 (ARIH2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARIH2 (10425)
Length:
6867
CDS:
3046..4596

Additional Resources:

NCBI RefSeq record:
XM_024453308.1
NBCI Gene record:
ARIH2 (10425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294442 AGCCCTCAAGAAGTACTTATT pLKO_005 4194 CDS 100% 13.200 18.480 N ARIH2 n/a
2 TRCN0000034272 GCTGGATGTGTCTAGGAGATT pLKO.1 4082 CDS 100% 4.950 6.930 N ARIH2 n/a
3 TRCN0000298272 GCTGGATGTGTCTAGGAGATT pLKO_005 4082 CDS 100% 4.950 6.930 N ARIH2 n/a
4 TRCN0000034269 CCTCCCAAATAAATTTGCTTT pLKO.1 5470 3UTR 100% 4.950 3.960 N ARIH2 n/a
5 TRCN0000034271 CGACTCTGAAACAGCCAACTA pLKO.1 3891 CDS 100% 4.950 3.960 N ARIH2 n/a
6 TRCN0000294396 GCAACACCTCTTAGTTGATTT pLKO_005 4727 3UTR 100% 13.200 9.240 N ARIH2 n/a
7 TRCN0000034270 CCTGCAATACACCTACCCATA pLKO.1 4383 CDS 100% 4.050 2.835 N ARIH2 n/a
8 TRCN0000034273 GAGGACTATTACGTGGGAGTA pLKO.1 3151 CDS 100% 4.050 2.835 N ARIH2 n/a
9 TRCN0000294440 CTGTGCCACAATCCGGAAATG pLKO_005 3852 CDS 100% 10.800 6.480 N ARIH2 n/a
10 TRCN0000041024 CCCAGGAAGAAGCTGTTTGAA pLKO.1 4426 CDS 100% 5.625 3.375 N Arih2 n/a
11 TRCN0000316889 CCCAGGAAGAAGCTGTTTGAA pLKO_005 4426 CDS 100% 5.625 3.375 N Arih2 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2257 5UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000041026 CCAATGAAGAATTGAGAGATA pLKO.1 3650 CDS 100% 4.950 2.970 N Arih2 n/a
14 TRCN0000316887 CCAATGAAGAATTGAGAGATA pLKO_005 3650 CDS 100% 4.950 2.970 N Arih2 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 438 5UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 438 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02426 pDONR223 100% 95.5% 95.3% None 962_1030del n/a
2 ccsbBroad304_02426 pLX_304 0% 95.5% 95.3% V5 962_1030del n/a
3 TRCN0000479033 TCAACTACTTGACCCAAAAACTCC pLX_317 25.9% 95.5% 95.3% V5 962_1030del n/a
Download CSV