Transcript: Human XM_024453367.1

PREDICTED: Homo sapiens C-X9-C motif containing 1 (CMC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMC1 (152100)
Length:
9921
CDS:
9295..9774

Additional Resources:

NCBI RefSeq record:
XM_024453367.1
NBCI Gene record:
CMC1 (152100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159829 GAATGTCTAACTGCTTACTAT pLKO.1 9637 CDS 100% 5.625 7.875 N CMC1 n/a
2 TRCN0000158699 GTCTAACTGCTTACTATAATG pLKO.1 9641 CDS 100% 13.200 9.240 N CMC1 n/a
3 TRCN0000162925 GAAGCTTCCAACAAGCATGTA pLKO.1 9753 CDS 100% 4.950 3.465 N CMC1 n/a
4 TRCN0000163439 GAATACCTGAAGGAAAGGGAA pLKO.1 9691 CDS 100% 2.640 1.848 N CMC1 n/a
5 TRCN0000162316 CAAGAACTCTGGAGTTCTTAT pLKO.1 9579 CDS 100% 1.320 0.924 N CMC1 n/a
6 TRCN0000162343 CTTACTATAATGATCCAGCCT pLKO.1 9650 CDS 100% 0.660 0.462 N CMC1 n/a
7 TRCN0000163406 GCAAGAACTCTGGAGTTCTTA pLKO.1 9578 CDS 100% 0.563 0.394 N CMC1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 534 5UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 573 5UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 573 5UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 573 5UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 535 5UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3305 5UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3068 5UTR 100% 0.495 0.248 Y C11orf44 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3305 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05063 pDONR223 100% 54.3% 43% None (many diffs) n/a
2 ccsbBroad304_05063 pLX_304 0% 54.3% 43% V5 (many diffs) n/a
Download CSV