Transcript: Human XM_024453668.1

PREDICTED: Homo sapiens interferon lambda receptor 1 (IFNLR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFNLR1 (163702)
Length:
4329
CDS:
396..1355

Additional Resources:

NCBI RefSeq record:
XM_024453668.1
NBCI Gene record:
IFNLR1 (163702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372651 CTCTTTAGGCTGAGCTATAAG pLKO_005 1549 3UTR 100% 13.200 18.480 N IFNLR1 n/a
2 TRCN0000058989 GCCGGAAACAAGACCCTATTT pLKO.1 422 CDS 100% 13.200 18.480 N IFNLR1 n/a
3 TRCN0000058992 ACACGTTCAGTGTCCCGAAAT pLKO.1 528 CDS 100% 10.800 15.120 N IFNLR1 n/a
4 TRCN0000372650 CCCTAGTTAGGCCCAGATAAA pLKO_005 1836 3UTR 100% 13.200 9.240 N IFNLR1 n/a
5 TRCN0000372589 GGAGGCGAGGGAATCAGAAAT pLKO_005 1244 CDS 100% 13.200 9.240 N IFNLR1 n/a
6 TRCN0000058990 CCAACAGACAAGATGGAAGAA pLKO.1 731 CDS 100% 4.950 3.465 N IFNLR1 n/a
7 TRCN0000058988 CCTACATTGAACCACCTTCTT pLKO.1 817 CDS 100% 4.950 3.465 N IFNLR1 n/a
8 TRCN0000058991 CTTGGGATTCTTCAGACAGAA pLKO.1 937 CDS 100% 4.950 3.465 N IFNLR1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3822 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3822 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05129 pDONR223 100% 61.3% 52.5% None 0_1ins472;197_198ins131 n/a
2 ccsbBroad304_05129 pLX_304 0% 61.3% 52.5% V5 0_1ins472;197_198ins131 n/a
3 TRCN0000479920 GAGTGCTCAAGCAACGTTACGTGC pLX_317 15% 61.3% 52.5% V5 0_1ins472;197_198ins131 n/a
Download CSV