Transcript: Human XM_024454133.1

PREDICTED: Homo sapiens DExD/H-box helicase 60 (DDX60), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDX60 (55601)
Length:
6126
CDS:
348..5486

Additional Resources:

NCBI RefSeq record:
XM_024454133.1
NBCI Gene record:
DDX60 (55601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413180 GCACTAACAACAGATCATATT pLKO_005 3369 CDS 100% 13.200 18.480 N DDX60 n/a
2 TRCN0000050183 GCGTATTTCAACTTCCCTGAA pLKO.1 624 CDS 100% 4.050 5.670 N DDX60 n/a
3 TRCN0000432304 ATGTTGTATGTGACTGAATAA pLKO_005 5778 3UTR 100% 13.200 9.240 N DDX60 n/a
4 TRCN0000422307 GTGTTACTTCATGCTCATTAT pLKO_005 1138 CDS 100% 13.200 9.240 N DDX60 n/a
5 TRCN0000050187 CCACTTTCCTACGAATTGTTT pLKO.1 4957 CDS 100% 5.625 3.938 N DDX60 n/a
6 TRCN0000050184 CCAATCAAAGACAGCTCCAAT pLKO.1 1677 CDS 100% 4.950 3.465 N DDX60 n/a
7 TRCN0000050185 CCTTTGAACAACTGAGTACAA pLKO.1 5437 CDS 100% 4.950 3.465 N DDX60 n/a
8 TRCN0000050186 GCAGAACATTAAAGATGCTTA pLKO.1 959 CDS 100% 4.950 3.465 N DDX60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12230 pDONR223 100% 10.6% 10.6% None 1_4587del n/a
2 ccsbBroad304_12230 pLX_304 0% 10.6% 10.6% V5 1_4587del n/a
3 TRCN0000470771 TGATGGTGATACCCCTCCATTAAC pLX_317 66% 10.6% 10.6% V5 1_4587del n/a
Download CSV