Transcript: Human XM_024454177.1

PREDICTED: Homo sapiens WD repeat domain 47 (WDR47), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR47 (22911)
Length:
4072
CDS:
64..2853

Additional Resources:

NCBI RefSeq record:
XM_024454177.1
NBCI Gene record:
WDR47 (22911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418414 GGCTAGTAACAATCGTTTATT pLKO_005 648 CDS 100% 15.000 21.000 N WDR47 n/a
2 TRCN0000415408 TGGACTAACCAGTCATGATAA pLKO_005 1050 CDS 100% 13.200 18.480 N WDR47 n/a
3 TRCN0000141310 CAGCAATGTAATGGGAGCAAA pLKO.1 1591 CDS 100% 4.950 6.930 N WDR47 n/a
4 TRCN0000140178 GCAAACTCTCTCCCTATCCAT pLKO.1 950 CDS 100% 3.000 4.200 N WDR47 n/a
5 TRCN0000122412 GCCGAGTTTAAGGACTGGAAT pLKO.1 532 CDS 100% 4.950 3.960 N WDR47 n/a
6 TRCN0000140780 GCGGCAGATATACCAACAGAT pLKO.1 1425 CDS 100% 4.950 3.960 N WDR47 n/a
7 TRCN0000433204 ACATCATAAAGGATCCATTTA pLKO_005 2061 CDS 100% 13.200 9.240 N WDR47 n/a
8 TRCN0000142705 CAGGACCAGCTAAACAAGAAA pLKO.1 1313 CDS 100% 5.625 3.938 N WDR47 n/a
9 TRCN0000141658 CCACAGGTCAAGAAGATTCTA pLKO.1 2540 CDS 100% 5.625 3.938 N WDR47 n/a
10 TRCN0000144036 CCAGGTGTTCAGAATTACTTT pLKO.1 3279 3UTR 100% 5.625 3.938 N WDR47 n/a
11 TRCN0000141513 CCCAGGTGTTCAGAATTACTT pLKO.1 3278 3UTR 100% 5.625 3.938 N WDR47 n/a
12 TRCN0000144749 GCAGAATCTTACTGAACAGTT pLKO.1 1491 CDS 100% 4.950 3.465 N WDR47 n/a
13 TRCN0000122390 GCTGATAGGAAGCTAAGTGAA pLKO.1 616 CDS 100% 4.950 3.465 N WDR47 n/a
14 TRCN0000141586 CTTCAGTTCATTCAGCCTCTA pLKO.1 256 CDS 100% 4.050 2.835 N WDR47 n/a
15 TRCN0000417733 AGTCCTTGTGGGCAGTTATTA pLKO_005 2095 CDS 100% 15.000 9.000 N WDR47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07815 pDONR223 100% 98.8% 98.7% None (many diffs) n/a
2 ccsbBroad304_07815 pLX_304 0% 98.8% 98.7% V5 (many diffs) n/a
3 TRCN0000473175 TGCTCAGTTTTTTACCTACCTAGT pLX_317 6.5% 98.8% 98.7% V5 (many diffs) n/a
4 ccsbBroadEn_11648 pDONR223 100% 96% 95.9% None (many diffs) n/a
5 ccsbBroad304_11648 pLX_304 0% 96% 95.9% V5 (many diffs) n/a
6 TRCN0000471169 GTCCAGGACGTTTATTCGTGAGGT pLX_317 17.7% 96% 95.9% V5 (many diffs) n/a
Download CSV