Transcript: Human XM_024454227.1

PREDICTED: Homo sapiens abhydrolase domain containing 18 (ABHD18), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABHD18 (80167)
Length:
2010
CDS:
106..1500

Additional Resources:

NCBI RefSeq record:
XM_024454227.1
NBCI Gene record:
ABHD18 (80167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263935 GCCAAAGAAGATGCCTATATT pLKO_005 1321 CDS 100% 15.000 21.000 N ABHD18 n/a
2 TRCN0000129188 CGAACAGGAGTTCGAAGTTTA pLKO.1 1345 CDS 100% 1.320 1.848 N ABHD18 n/a
3 TRCN0000263933 TCATACCACCTACTTAGTAAA pLKO_005 1177 CDS 100% 13.200 10.560 N ABHD18 n/a
4 TRCN0000263931 GACAAGCTAACTAACCTTAAT pLKO_005 961 CDS 100% 13.200 9.240 N ABHD18 n/a
5 TRCN0000263934 TGGAACAGGAGATCATCATTA pLKO_005 447 CDS 100% 13.200 9.240 N ABHD18 n/a
6 TRCN0000147139 CAGACAAGCTAACTAACCTTA pLKO.1 959 CDS 100% 4.950 3.465 N ABHD18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12675 pDONR223 100% 70.6% 69.8% None (many diffs) n/a
2 ccsbBroad304_12675 pLX_304 0% 70.6% 69.8% V5 (many diffs) n/a
3 TRCN0000475662 CCTCAGTGAGCCAAGCCACAAATC pLX_317 28.2% 70.6% 69.8% V5 (many diffs) n/a
4 ccsbBroadEn_12676 pDONR223 100% 69.1% 69.1% None 1_381del;1344_1392delinsG n/a
5 ccsbBroad304_12676 pLX_304 0% 69.1% 69.1% V5 1_381del;1344_1392delinsG n/a
6 TRCN0000480245 AGGGTAGTTCTAAACACTCTTCTT pLX_317 29.2% 69.1% 69.1% V5 1_381del;1344_1392delinsG n/a
Download CSV