Transcript: Human XM_024454360.1

PREDICTED: Homo sapiens NAD kinase 2, mitochondrial (NADK2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NADK2 (133686)
Length:
3498
CDS:
334..1239

Additional Resources:

NCBI RefSeq record:
XM_024454360.1
NBCI Gene record:
NADK2 (133686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001487085 AATGTGTATATCGAACGGGC pXPR_003 AGG 95 10% 5 0.725 NADK2 NADK2 78093
2 BRDN0001147240 ACTAAATGAAGTCTTCATTG pXPR_003 GGG 349 39% 7 0.2954 NADK2 NADK2 78092
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435654 AGCAGTCGTCAGCGTTGTTTC pLKO_005 1072 CDS 100% 10.800 15.120 N NADK2 n/a
2 TRCN0000128515 CTAAGCTTGAATCAGCACAAT pLKO.1 571 CDS 100% 4.950 6.930 N NADK2 n/a
3 TRCN0000024980 CGACATCATATTCACACCAAA pLKO.1 184 5UTR 100% 4.950 3.960 N Nadk2 n/a
4 TRCN0000024983 GCTGTAGCAGTGGACAATTTA pLKO.1 721 CDS 100% 15.000 10.500 N Nadk2 n/a
5 TRCN0000414087 GAACGGTCTGAGGGTCATTTA pLKO_005 400 CDS 100% 13.200 9.240 N NADK2 n/a
6 TRCN0000432997 GAACTGAACACATATCATTTG pLKO_005 1616 3UTR 100% 10.800 7.560 N NADK2 n/a
7 TRCN0000128286 GAGAGCACTAAATGAAGTCTT pLKO.1 660 CDS 100% 4.950 3.465 N NADK2 n/a
8 TRCN0000130907 GCTAAGCTTGAATCAGCACAA pLKO.1 570 CDS 100% 4.050 2.835 N NADK2 n/a
9 TRCN0000130058 GTATTCGAGAACCAATAGCAA pLKO.1 1037 CDS 100% 3.000 2.100 N NADK2 n/a
10 TRCN0000424042 GAGGCAGAGAATCAGGTTATA pLKO_005 498 CDS 100% 13.200 7.920 N NADK2 n/a
11 TRCN0000128285 GCAGGCTTAAATAAAGGACTA pLKO.1 1523 3UTR 100% 4.050 2.430 N NADK2 n/a
12 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 3110 3UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04884 pDONR223 100% 92.6% 92.6% None 372_437del n/a
2 TRCN0000466703 ACAAATACCTATTAGCCAATGAGA pLX_317 50.6% 92.6% 92.6% V5 372_437del n/a
3 TRCN0000487878 CTCATTTACATACACTTAACTCTT pLX_317 35.4% 92.6% 92.6% V5 (not translated due to prior stop codon) 372_437del n/a
4 TRCN0000489766 AGCCGATCCTTTATGCTTTCGTAC pLX_317 50.2% 92.5% 92.3% V5 372_437del;903_904insG n/a
Download CSV