Transcript: Mouse XM_030245663.1

PREDICTED: Mus musculus septin 4 (Sept4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sept4 (18952)
Length:
2474
CDS:
96..2471

Additional Resources:

NCBI RefSeq record:
XM_030245663.1
NBCI Gene record:
Sept4 (18952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030245663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416344 GAGAATCTGGTCTGGGTAAAT pLKO_005 2026 CDS 100% 13.200 18.480 N Sept4 n/a
2 TRCN0000161166 GAGCAAGTTCGTGAAGGATTT pLKO.1 1676 CDS 100% 10.800 7.560 N SEPTIN4 n/a
3 TRCN0000101738 GCAAGCTTGATCCTTATGATT pLKO.1 1903 CDS 100% 5.625 3.938 N Sept4 n/a
4 TRCN0000164663 CTGAGCAAGTTCGTGAAGGAT pLKO.1 1674 CDS 100% 3.000 2.100 N SEPTIN4 n/a
5 TRCN0000155973 CCAGCAGTTTGAGCAGTACTT pLKO.1 2264 CDS 100% 4.950 2.970 N SEPTIN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030245663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01233 pDONR223 100% 26.8% 23.1% None (many diffs) n/a
2 ccsbBroad304_01233 pLX_304 0% 26.8% 23.1% V5 (many diffs) n/a
3 TRCN0000481592 ATGCAACTCATTTCAGGTCCTCCG pLX_317 29.2% 25.4% 23% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000476347 CCATTTCCAACTATGATTTCGGGC pLX_317 25.8% 25.4% 23% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV