Transcript: Mouse XM_030247616.1

PREDICTED: Mus musculus calcium channel, voltage-dependent, alpha2/delta subunit 3 (Cacna2d3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cacna2d3 (12294)
Length:
3177
CDS:
166..3159

Additional Resources:

NCBI RefSeq record:
XM_030247616.1
NBCI Gene record:
Cacna2d3 (12294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030247616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069026 CGGGATGATGTGTTACGAAAT pLKO.1 1582 CDS 100% 10.800 15.120 N Cacna2d3 n/a
2 TRCN0000045163 CCCATTGAAATCAGGTATAAT pLKO.1 2968 CDS 100% 15.000 10.500 N CACNA2D3 n/a
3 TRCN0000045165 GCACACCTGAAACATGAATTT pLKO.1 229 CDS 100% 13.200 9.240 N CACNA2D3 n/a
4 TRCN0000069024 GCACCCATTGAAATCAGGTAT pLKO.1 2965 CDS 100% 4.950 3.465 N Cacna2d3 n/a
5 TRCN0000069025 GCCATTGTCAATGGAGTGTAT pLKO.1 433 CDS 100% 4.950 3.465 N Cacna2d3 n/a
6 TRCN0000069023 GCCCTCAACAAATCTGAGAAT pLKO.1 2017 CDS 100% 4.950 3.465 N Cacna2d3 n/a
7 TRCN0000069027 CCTTCAACATACTGAGCGATT pLKO.1 917 CDS 100% 4.050 2.835 N Cacna2d3 n/a
8 TRCN0000045164 GCCTGTGTTTAGTAAGCAGAA pLKO.1 1326 CDS 100% 4.050 2.835 N CACNA2D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030247616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08590 pDONR223 100% 82.1% 89.9% None (many diffs) n/a
2 ccsbBroad304_08590 pLX_304 0% 82.1% 89.9% V5 (many diffs) n/a
3 TRCN0000492057 AAGTTTCTGTGCTCACCTTCCAGT pLX_317 10.6% 82.1% 89.9% V5 (many diffs) n/a
Download CSV