Transcript: Mouse XM_030247866.1

PREDICTED: Mus musculus sodium leak channel, non-selective (Nalcn), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Nalcn (338370)
Length:
8200
CDS:
470..5710

Additional Resources:

NCBI RefSeq record:
XM_030247866.1
NBCI Gene record:
Nalcn (338370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030247866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429237 TGCGGGTAGTCCGGCTTATTA pLKO_005 1908 CDS 100% 15.000 21.000 N Nalcn n/a
2 TRCN0000413622 TCATGTGTACCCAGATCTTTA pLKO_005 1858 CDS 100% 13.200 9.240 N Nalcn n/a
3 TRCN0000412654 TGCAGAAATCAGAGTACAATT pLKO_005 1444 CDS 100% 13.200 9.240 N Nalcn n/a
4 TRCN0000440299 CCTACCACTGTGTAGTCAATG pLKO_005 1080 CDS 100% 10.800 7.560 N Nalcn n/a
5 TRCN0000413315 TATCATCTCTTTGCAACTTTG pLKO_005 2213 CDS 100% 10.800 7.560 N Nalcn n/a
6 TRCN0000173744 CCTTTGGGTATCTCTTGTGTT pLKO.1 820 CDS 100% 4.950 3.465 N Nalcn n/a
7 TRCN0000174609 GAGAACAAATATGGAGTGTTT pLKO.1 993 CDS 100% 4.950 3.465 N Nalcn n/a
8 TRCN0000193446 GTGTTTGAAATAGCTGACATA pLKO.1 845 CDS 100% 4.950 3.465 N Nalcn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030247866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13485 pDONR223 100% 32.6% 34.6% None (many diffs) n/a
2 ccsbBroad304_13485 pLX_304 0% 32.6% 34.6% V5 (many diffs) n/a
3 TRCN0000476819 AGTCCACTTCATTGGAAGCTGTTC pLX_317 18.1% 32.6% 34.6% V5 (many diffs) n/a
4 ccsbBroadEn_13486 pDONR223 100% 11.2% 12.3% None (many diffs) n/a
5 ccsbBroad304_13486 pLX_304 0% 11.2% 12.3% V5 (many diffs) n/a
6 TRCN0000469868 GCACTGACACATTAACGCTCCAGC pLX_317 65.8% 11.2% 12.3% V5 (many diffs) n/a
Download CSV