Transcript: Mouse XM_485502.8

PREDICTED: Mus musculus predicted gene 13202 (Gm13202), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chchd2-ps (433806)
Length:
600
CDS:
70..531

Additional Resources:

NCBI RefSeq record:
XM_485502.8
NBCI Gene record:
Chchd2-ps (433806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_485502.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215977 CAGGATTGCAAATGGTTTAAT pLKO.1 507 CDS 100% 15.000 7.500 Y Chchd2 n/a
2 TRCN0000251042 CAGGATTGCAAATGGTTTAAT pLKO_005 507 CDS 100% 15.000 7.500 Y Chchd2 n/a
3 TRCN0000251040 CTCTAGAGATCAAGCAGTTTC pLKO_005 419 CDS 100% 10.800 5.400 Y Chchd2 n/a
4 TRCN0000251041 GCAAAGCCCGACATCACTTAC pLKO_005 346 CDS 100% 10.800 5.400 Y Chchd2 n/a
5 TRCN0000184420 GACCTTGCTCTCTAGAGATCA pLKO.1 410 CDS 100% 4.950 2.475 Y Chchd2 n/a
6 TRCN0000265318 TCAGAACCAGAGCGATGTCAA pLKO_005 450 CDS 100% 4.950 2.475 Y Chchd2 n/a
7 TRCN0000180376 GTACAAGTGTGGACCCTTATA pLKO.1 582 3UTR 100% 13.200 6.600 Y Chchd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_485502.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03226 pDONR223 100% 82% 83.6% None (many diffs) n/a
2 ccsbBroad304_03226 pLX_304 0% 82% 83.6% V5 (many diffs) n/a
3 TRCN0000465810 ATACCTTGAAAATTCGGAATATGT pLX_317 85.6% 82% 83.6% V5 (many diffs) n/a
Download CSV