Transcript: Human XR_001737078.1

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C16 (DNAJC16), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC16 (23341)
Length:
2765
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737078.1
NBCI Gene record:
DNAJC16 (23341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294366 ATCTCGACCAGCTGCGTAAAG pLKO_005 1725 3UTR 100% 10.800 15.120 N DNAJC16 n/a
2 TRCN0000064149 GCTTACGAGATTCTTTCAAAT pLKO.1 509 3UTR 100% 13.200 10.560 N DNAJC16 n/a
3 TRCN0000291560 GCTTACGAGATTCTTTCAAAT pLKO_005 509 3UTR 100% 13.200 10.560 N DNAJC16 n/a
4 TRCN0000294309 CCTCTATCCTAGGAATCATTA pLKO_005 930 3UTR 100% 13.200 9.240 N DNAJC16 n/a
5 TRCN0000294364 AGCGTGACTACACTGGTTATG pLKO_005 2474 3UTR 100% 10.800 7.560 N DNAJC16 n/a
6 TRCN0000064152 GCAGAAGACAAGTTCATTCAA pLKO.1 479 3UTR 100% 5.625 3.938 N DNAJC16 n/a
7 TRCN0000298265 GCAGAAGACAAGTTCATTCAA pLKO_005 479 3UTR 100% 5.625 3.938 N DNAJC16 n/a
8 TRCN0000064150 CCCGAGGTATGAAGAAGCAAA pLKO.1 1308 3UTR 100% 4.950 3.465 N DNAJC16 n/a
9 TRCN0000064148 GCCTTTGCATACAAAGATTAT pLKO.1 1154 3UTR 100% 1.320 0.924 N DNAJC16 n/a
10 TRCN0000298267 GCCTTTGCATACAAAGATTAT pLKO_005 1154 3UTR 100% 1.320 0.924 N DNAJC16 n/a
11 TRCN0000064151 CCACATGAATGTGGTCCTCAT pLKO.1 2265 3UTR 100% 0.405 0.284 N DNAJC16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02754 pDONR223 100% 84.8% None 1_283del;2062_2180del;2749_2765del n/a
2 ccsbBroad304_02754 pLX_304 0% 84.8% V5 1_283del;2062_2180del;2749_2765del n/a
Download CSV