Transcript: Human XR_001737110.1

PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X19, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNM3 (26052)
Length:
7520
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737110.1
NBCI Gene record:
DNM3 (26052)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380405 CAAATGTATCCGAGATCTAAT pLKO_005 2056 3UTR 100% 13.200 18.480 N DNM3 n/a
2 TRCN0000380780 GGTAGCTCATTAAACGTAATT pLKO_005 2972 3UTR 100% 13.200 18.480 N DNM3 n/a
3 TRCN0000051404 CGAATGTATCAAGCACTGAAA pLKO.1 2222 3UTR 100% 4.950 6.930 N DNM3 n/a
4 TRCN0000051407 CCCACTATAATCCGCCCACTA pLKO.1 2603 3UTR 100% 4.050 5.670 N DNM3 n/a
5 TRCN0000051406 CGAGGGAGAACTGTCTGATTT pLKO.1 656 3UTR 100% 13.200 10.560 N DNM3 n/a
6 TRCN0000379467 ATTTCCTCCATACCCATTAAT pLKO_005 505 3UTR 100% 15.000 10.500 N DNM3 n/a
7 TRCN0000381645 GTGTCTGGCATGGCAATTAAT pLKO_005 2650 3UTR 100% 15.000 10.500 N DNM3 n/a
8 TRCN0000379523 GTGTTAAATCTAACCCTTATT pLKO_005 547 3UTR 100% 13.200 9.240 N DNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11804 pDONR223 100% 22% None (many diffs) n/a
2 ccsbBroad304_11804 pLX_304 0% 22% V5 (many diffs) n/a
3 TRCN0000468730 GATCTCCAGAATTACCCCTGCCCC pLX_317 23.8% 22% V5 (many diffs) n/a
Download CSV