Transcript: Human XR_001737260.1

PREDICTED: Homo sapiens crystallin beta-gamma domain containing 2 (CRYBG2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRYBG2 (55057)
Length:
5117
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737260.1
NBCI Gene record:
CRYBG2 (55057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162601 CCCAAGGAATAAGTTTGTTCA pLKO.1 1459 3UTR 100% 4.950 3.465 N CRYBG2 n/a
2 TRCN0000166608 CGAGAGGAAGTGGAAGTCAAT pLKO.1 314 3UTR 100% 4.950 3.465 N CRYBG2 n/a
3 TRCN0000163037 GCAGAAGGAGATGTTTGAGTT pLKO.1 286 3UTR 100% 4.950 3.465 N CRYBG2 n/a
4 TRCN0000164714 CAGCAGAGCTTAAAGACAGCT pLKO.1 981 3UTR 100% 2.640 1.848 N CRYBG2 n/a
5 TRCN0000163642 GAAAGTGCTAAGTAACCTCGT pLKO.1 841 3UTR 100% 2.160 1.512 N CRYBG2 n/a
6 TRCN0000165818 GCAGAGCTTAAAGACAGCTCT pLKO.1 983 3UTR 100% 0.264 0.185 N CRYBG2 n/a
7 TRCN0000164189 CAGGAAGAAGAGACTGTGAAT pLKO.1 347 3UTR 100% 4.950 2.970 N CRYBG2 n/a
8 TRCN0000163150 GAAGTGGAAGTCAATGGCTTT pLKO.1 320 3UTR 100% 4.050 2.430 N CRYBG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12147 pDONR223 100% 33.1% None 1_3271del;4205_4206ins113;5007_5117del n/a
2 ccsbBroad304_12147 pLX_304 0% 33.1% V5 1_3271del;4205_4206ins113;5007_5117del n/a
3 TRCN0000481400 ACACTTGTGTCTAGTGCGGATGTA pLX_317 21.2% 33.1% V5 1_3271del;4205_4206ins113;5007_5117del n/a
Download CSV