Transcript: Human XR_001737373.2

PREDICTED: Homo sapiens G protein-coupled receptor 89A (GPR89A), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR89A (653519)
Length:
2519
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737373.2
NBCI Gene record:
GPR89A (653519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244549 CTTCATTCTTGTTGGAATAAT pLKO_005 1246 3UTR 100% 15.000 7.500 Y GPR89B n/a
2 TRCN0000243822 GAATAGCAGCTCCCGTTATTT pLKO_005 315 3UTR 100% 15.000 7.500 Y GPR89A n/a
3 TRCN0000244548 TTCATGGCTACCATCAATATT pLKO_005 1118 3UTR 100% 15.000 7.500 Y GPR89B n/a
4 TRCN0000243824 ATGTGACTGACACGGATATTC pLKO_005 656 3UTR 100% 13.200 6.600 Y GPR89A n/a
5 TRCN0000358298 ATTACCTCCCAGATACTATTT pLKO_005 148 3UTR 100% 13.200 6.600 Y GPR89B n/a
6 TRCN0000014506 CCTGCTATTAGCACAGATAAT pLKO.1 1354 3UTR 100% 13.200 6.600 Y GPR89B n/a
7 TRCN0000014504 CCTTCATTCTTGTTGGAATAA pLKO.1 1245 3UTR 100% 13.200 6.600 Y GPR89B n/a
8 TRCN0000243823 GATTACCTCCCAGATACTATT pLKO_005 147 3UTR 100% 13.200 6.600 Y GPR89A n/a
9 TRCN0000244550 TCTGGAAACAGCTGATCTATA pLKO_005 1000 3UTR 100% 13.200 6.600 Y GPR89B n/a
10 TRCN0000363142 TGAATAGCAGCTCCCGTTATT pLKO_005 314 3UTR 100% 13.200 6.600 Y GPR89B n/a
11 TRCN0000243825 TGGAACCAGGGCCTGACATTT pLKO_005 1650 3UTR 100% 13.200 6.600 Y GPR89A n/a
12 TRCN0000244551 TTAGAATACCGCACCATAATC pLKO_005 1424 3UTR 100% 13.200 6.600 Y GPR89B n/a
13 TRCN0000243821 ACTATGAGATACGTCAGTATG pLKO_005 212 3UTR 100% 10.800 5.400 Y GPR89A n/a
14 TRCN0000358303 CAATATCCGACTACTGCATAA pLKO_005 417 3UTR 100% 10.800 5.400 Y GPR89B n/a
15 TRCN0000244552 TGAGCCAAACACGTAGGATTT pLKO_005 1912 3UTR 100% 10.800 5.400 Y GPR89B n/a
16 TRCN0000014505 CGCCAATTGTTTAAAGACTAT pLKO.1 196 3UTR 100% 4.950 2.475 Y GPR89B n/a
17 TRCN0000014507 CGCTCTCTCTAGCATACTCTT pLKO.1 1513 3UTR 100% 4.950 2.475 Y GPR89B n/a
18 TRCN0000014503 GCCAAGAAACTAAAGGTGAAA pLKO.1 1851 3UTR 100% 4.950 2.475 Y GPR89B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489448 TTCGCTAATGTGAAGCACCGCCCG pLX_317 23.4% 54.1% V5 1_117del;845_941del;1580_2519delinsG n/a
2 ccsbBroadEn_14517 pDONR223 100% 54.1% None (many diffs) n/a
3 ccsbBroad304_14517 pLX_304 0% 54.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479192 GTTGGTCCATCTGCCGAGCCGACT pLX_317 29.6% 54.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV