Transcript: Human XR_001738608.1

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 21 (PPP1R21), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R21 (129285)
Length:
3278
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738608.1
NBCI Gene record:
PPP1R21 (129285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161152 CGAACGGAAGAATGTCAATTA pLKO.1 739 3UTR 100% 13.200 18.480 N PPP1R21 n/a
2 TRCN0000433993 GAACGGTTGCATATACAATTT pLKO_005 511 3UTR 100% 13.200 18.480 N PPP1R21 n/a
3 TRCN0000159146 GCATGAATGAGACATTATCTA pLKO.1 2545 3UTR 100% 5.625 7.875 N PPP1R21 n/a
4 TRCN0000162399 CGAGGATCAGTTAAGTATGAT pLKO.1 2507 3UTR 100% 5.625 4.500 N PPP1R21 n/a
5 TRCN0000161022 GTGGATTCATTAGTCCTCTTT pLKO.1 1670 3UTR 100% 4.950 3.960 N PPP1R21 n/a
6 TRCN0000415813 ATCTCGTGAAGACTTAATTAA pLKO_005 2276 3UTR 100% 15.000 10.500 N PPP1R21 n/a
7 TRCN0000420625 AGATTCTTCCCTATCAGTTAA pLKO_005 1217 3UTR 100% 13.200 9.240 N PPP1R21 n/a
8 TRCN0000424463 AGCTGAAGATGCGAGATATTG pLKO_005 899 3UTR 100% 13.200 9.240 N PPP1R21 n/a
9 TRCN0000160578 CAGAAGCTGATAACAACTAAT pLKO.1 1531 3UTR 100% 13.200 9.240 N PPP1R21 n/a
10 TRCN0000428030 TGAACGTTCCACTCCACAATA pLKO_005 869 3UTR 100% 13.200 9.240 N PPP1R21 n/a
11 TRCN0000420304 TGACGTTATGAAAGATATTTC pLKO_005 1458 3UTR 100% 13.200 9.240 N PPP1R21 n/a
12 TRCN0000160197 CGATTTGGTATCTATGGAATA pLKO.1 2984 3UTR 100% 10.800 7.560 N PPP1R21 n/a
13 TRCN0000419711 CTCTTTGCACATCTGCGTTAA pLKO_005 1265 3UTR 100% 10.800 7.560 N PPP1R21 n/a
14 TRCN0000413901 GATGGACTCCTTCGGACAAAC pLKO_005 1390 3UTR 100% 10.800 7.560 N PPP1R21 n/a
15 TRCN0000163353 GCCTTCAGGAAGCTAAAGTAT pLKO.1 2724 3UTR 100% 5.625 3.938 N PPP1R21 n/a
16 TRCN0000162313 CCATTGACACTATATCTCCAT pLKO.1 1019 3UTR 100% 2.640 1.848 N PPP1R21 n/a
17 TRCN0000166013 GCTGACAGTAAGTCAGTGCAT pLKO.1 2346 3UTR 100% 0.264 0.185 N PPP1R21 n/a
18 TRCN0000162521 CCTAGTAAACTAGTCAGTGTT pLKO.1 2752 3UTR 100% 0.000 0.000 N PPP1R21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04850 pDONR223 100% 71.3% None 1_153del;2120_2259del;2634_3278del n/a
2 ccsbBroadEn_13142 pDONR223 100% 33.1% None 1_153del;1242_3278delinsG n/a
3 ccsbBroad304_13142 pLX_304 0% 33.1% V5 1_153del;1242_3278delinsG n/a
4 TRCN0000469788 TACCACTGTTAAGACACATGGTGA pLX_317 33.2% 33.1% V5 1_153del;1242_3278delinsG n/a
Download CSV