Transcript: Human XR_001738623.2

PREDICTED: Homo sapiens chromosome 2 open reading frame 76 (C2orf76), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2orf76 (130355)
Length:
722
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738623.2
NBCI Gene record:
C2orf76 (130355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121727 CAATTTCAAACCTGTAGTGTA pLKO.1 160 3UTR 100% 4.950 6.930 N C2orf76 n/a
2 TRCN0000122352 CACGGAGTGAATTTGGACCAA pLKO.1 182 3UTR 100% 2.640 3.696 N C2orf76 n/a
3 TRCN0000139520 CCGTTCCTTTGAACATCGCAA pLKO.1 142 3UTR 100% 2.640 2.112 N C2orf76 n/a
4 TRCN0000140687 GACGAAAGACTCCTGCTGAAA pLKO.1 356 3UTR 100% 4.950 3.465 N C2orf76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04860 pDONR223 100% 48.4% None (many diffs) n/a
2 ccsbBroad304_04860 pLX_304 0% 48.4% V5 (many diffs) n/a
3 TRCN0000470846 AAGGCAACAGCAAATGCTGTGGCG pLX_317 94.7% 48.4% V5 (many diffs) n/a
Download CSV