Transcript: Human XR_001738826.2

PREDICTED: Homo sapiens interacts with SUPT6H, CTD assembly factor 1 (IWS1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IWS1 (55677)
Length:
2991
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738826.2
NBCI Gene record:
IWS1 (55677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160946 GAGAACGATGAGCCCTTAAAT pLKO.1 489 3UTR 100% 15.000 21.000 N IWS1 n/a
2 TRCN0000365090 GACGGTGAGGATGATGTAAAT pLKO_005 363 3UTR 100% 13.200 18.480 N IWS1 n/a
3 TRCN0000370040 TGGAAGTGTAGAACGTCATTC pLKO_005 407 3UTR 100% 10.800 15.120 N IWS1 n/a
4 TRCN0000164040 CGCAATGGACTCTTTGGAGAA pLKO.1 2796 3UTR 100% 4.050 5.670 N IWS1 n/a
5 TRCN0000164058 CCCGAATCAGTGATTCGGAAA pLKO.1 1093 3UTR 100% 0.405 0.567 N IWS1 n/a
6 TRCN0000365089 TGAGTGGTCTAGGCCTATATT pLKO_005 2330 3UTR 100% 15.000 10.500 N IWS1 n/a
7 TRCN0000370083 ATGCCTCAACGACGAAGAATG pLKO_005 2415 3UTR 100% 10.800 7.560 N IWS1 n/a
8 TRCN0000376549 GCTCTCACCTCTACCAGATAG pLKO_005 2138 3UTR 100% 10.800 7.560 N IWS1 n/a
9 TRCN0000162073 CCTCGAATGAGTGATTCTGAA pLKO.1 897 3UTR 100% 4.950 3.465 N IWS1 n/a
10 TRCN0000161316 GCAATGGACTCTTTGGAGAAA pLKO.1 2797 3UTR 100% 4.950 3.465 N IWS1 n/a
11 TRCN0000161110 GCTGTGCTTTCTGATAGTGAA pLKO.1 1464 3UTR 100% 4.950 3.465 N IWS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465982 TTTTGGTTGACGGAGATATTCTGT pLX_317 13.3% 81.9% V5 (many diffs) n/a
2 ccsbBroadEn_12249 pDONR223 100% 5.2% None 1_1638del;1795_2991del n/a
3 ccsbBroad304_12249 pLX_304 0% 5.2% V5 1_1638del;1795_2991del n/a
4 TRCN0000471391 TAAAAACCGCAAATACATCTTTGC pLX_317 100% 5.2% V5 1_1638del;1795_2991del n/a
Download CSV