Transcript: Human XR_001738832.1

PREDICTED: Homo sapiens interacts with SUPT6H, CTD assembly factor 1 (IWS1), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IWS1 (55677)
Length:
2697
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738832.1
NBCI Gene record:
IWS1 (55677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160946 GAGAACGATGAGCCCTTAAAT pLKO.1 425 3UTR 100% 15.000 21.000 N IWS1 n/a
2 TRCN0000365090 GACGGTGAGGATGATGTAAAT pLKO_005 299 3UTR 100% 13.200 18.480 N IWS1 n/a
3 TRCN0000370040 TGGAAGTGTAGAACGTCATTC pLKO_005 343 3UTR 100% 10.800 15.120 N IWS1 n/a
4 TRCN0000164040 CGCAATGGACTCTTTGGAGAA pLKO.1 2502 3UTR 100% 4.050 5.670 N IWS1 n/a
5 TRCN0000163813 CGACGAAGAATGAACAGCACT pLKO.1 2144 3UTR 100% 2.640 3.696 N IWS1 n/a
6 TRCN0000164058 CCCGAATCAGTGATTCGGAAA pLKO.1 1029 3UTR 100% 0.405 0.567 N IWS1 n/a
7 TRCN0000365089 TGAGTGGTCTAGGCCTATATT pLKO_005 2050 3UTR 100% 15.000 10.500 N IWS1 n/a
8 TRCN0000370083 ATGCCTCAACGACGAAGAATG pLKO_005 2135 3UTR 100% 10.800 7.560 N IWS1 n/a
9 TRCN0000376549 GCTCTCACCTCTACCAGATAG pLKO_005 1976 3UTR 100% 10.800 7.560 N IWS1 n/a
10 TRCN0000162073 CCTCGAATGAGTGATTCTGAA pLKO.1 833 3UTR 100% 4.950 3.465 N IWS1 n/a
11 TRCN0000161316 GCAATGGACTCTTTGGAGAAA pLKO.1 2503 3UTR 100% 4.950 3.465 N IWS1 n/a
12 TRCN0000161110 GCTGTGCTTTCTGATAGTGAA pLKO.1 1400 3UTR 100% 4.950 3.465 N IWS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465982 TTTTGGTTGACGGAGATATTCTGT pLX_317 13.3% 76.5% V5 (many diffs) n/a
2 ccsbBroadEn_12249 pDONR223 100% 5.1% None (many diffs) n/a
3 ccsbBroad304_12249 pLX_304 0% 5.1% V5 (many diffs) n/a
4 TRCN0000471391 TAAAAACCGCAAATACATCTTTGC pLX_317 100% 5.1% V5 (many diffs) n/a
Download CSV