Transcript: Human XR_001738853.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 7A (TTC7A), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC7A (57217)
Length:
3310
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738853.2
NBCI Gene record:
TTC7A (57217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130278 CGATGACTTTGGGAAATTGCT pLKO.1 495 3UTR 100% 3.000 4.200 N TTC7A n/a
2 TRCN0000131173 GCAAGATGAATTGCACCGGAA pLKO.1 1839 3UTR 100% 2.160 3.024 N TTC7A n/a
3 TRCN0000128934 CCAAAGCAACTCAGAACTTCA pLKO.1 1130 3UTR 100% 4.950 3.465 N TTC7A n/a
4 TRCN0000128543 CGTTTGGAGAATTTCACCTTT pLKO.1 1541 3UTR 100% 4.950 3.465 N TTC7A n/a
5 TRCN0000129208 CTGAAGTCCAAGCAAGATGAA pLKO.1 1828 3UTR 100% 4.950 3.465 N TTC7A n/a
6 TRCN0000129572 CGAGCCATGAAGTTTGCGTTT pLKO.1 1525 3UTR 100% 4.050 2.835 N TTC7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12338 pDONR223 100% 38.6% None (many diffs) n/a
2 ccsbBroad304_12338 pLX_304 0% 38.6% V5 (many diffs) n/a
3 TRCN0000480913 CCACGCTACAAGCTGTTAGGAAGT pLX_317 26.4% 38.6% V5 (many diffs) n/a
Download CSV