Transcript: Human XR_001738892.1

PREDICTED: Homo sapiens serine and arginine rich splicing factor 7 (SRSF7), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRSF7 (6432)
Length:
1133
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738892.1
NBCI Gene record:
SRSF7 (6432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001142 GAACTGTATGGATTGCGAGAA pLKO.1 218 3UTR 100% 4.050 5.670 N SRSF7 n/a
2 TRCN0000273460 GAACTGTATGGATTGCGAGAA pLKO_005 218 3UTR 100% 4.050 5.670 N SRSF7 n/a
3 TRCN0000273401 GATCAAGATCCAGGTCTATTT pLKO_005 802 3UTR 100% 13.200 9.240 N SRSF7 n/a
4 TRCN0000273400 CCTCGACGATCAAGATCTATC pLKO_005 690 3UTR 100% 10.800 7.560 N SRSF7 n/a
5 TRCN0000273402 GTCACGGTCTAGATCACATTC pLKO_005 599 3UTR 100% 10.800 7.560 N SRSF7 n/a
6 TRCN0000001143 AGGACTGGATGGAAAGGTGAT pLKO.1 300 3UTR 100% 4.050 2.835 N SRSF7 n/a
7 TRCN0000001141 GATGCTATGAGTGTGGCGAAA pLKO.1 419 3UTR 100% 4.050 2.835 N SRSF7 n/a
8 TRCN0000001144 AGCAGGTTTCTTCGTTTGAGT pLKO.1 487 3UTR 100% 3.000 2.100 N SRSF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01525 pDONR223 100% 57.9% None (many diffs) n/a
2 ccsbBroad304_01525 pLX_304 0% 57.9% V5 (many diffs) n/a
3 TRCN0000467489 GCCCAGCAACTTAAATCGTCGGAT pLX_317 50.4% 57.9% V5 (many diffs) n/a
Download CSV