Transcript: Human XR_001738958.1

PREDICTED: Homo sapiens nucleolar protein 10 (NOL10), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOL10 (79954)
Length:
3081
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738958.1
NBCI Gene record:
NOL10 (79954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151973 CGATGTTATGACACCTATCAA pLKO.1 346 3UTR 100% 5.625 7.875 N NOL10 n/a
2 TRCN0000153723 CCAGAGCATGACCTTAATGAT pLKO.1 1045 3UTR 100% 5.625 3.938 N NOL10 n/a
3 TRCN0000152253 CCTTGAAGTTTGAAAGGTGTT pLKO.1 371 3UTR 100% 4.050 2.835 N NOL10 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1361 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1362 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04150 pDONR223 100% 54.4% None (many diffs) n/a
2 ccsbBroad304_04150 pLX_304 0% 54.4% V5 (many diffs) n/a
3 TRCN0000474127 CCTCGCTTTTACACCCGGAGTCTA pLX_317 20.9% 54.4% V5 (many diffs) n/a
Download CSV