Transcript: Human XR_001739019.1

PREDICTED: Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 5 (ST3GAL5), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST3GAL5 (8869)
Length:
2519
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001739019.1
NBCI Gene record:
ST3GAL5 (8869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001739019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036135 CCCTGAACACTTGAAAGCCAA pLKO.1 634 3UTR 100% 2.640 3.696 N ST3GAL5 n/a
2 TRCN0000323262 CATTGAATACAGGTAACTAAT pLKO_005 1851 3UTR 100% 13.200 10.560 N ST3GAL5 n/a
3 TRCN0000036138 CCACTGTCTGACCTTGAATAT pLKO.1 1011 3UTR 100% 13.200 9.240 N ST3GAL5 n/a
4 TRCN0000301137 CCACTGTCTGACCTTGAATAT pLKO_005 1011 3UTR 100% 13.200 9.240 N ST3GAL5 n/a
5 TRCN0000036137 GTGGAGGCATTGATCGTGAAT pLKO.1 1498 3UTR 100% 4.950 3.465 N ST3GAL5 n/a
6 TRCN0000301057 GTGGAGGCATTGATCGTGAAT pLKO_005 1498 3UTR 100% 4.950 3.465 N ST3GAL5 n/a
7 TRCN0000036136 GCTCAGAAATATGCTCAGCAA pLKO.1 407 3UTR 100% 2.640 1.848 N ST3GAL5 n/a
8 TRCN0000301138 GCTCAGAAATATGCTCAGCAA pLKO_005 407 3UTR 100% 2.640 1.848 N ST3GAL5 n/a
9 TRCN0000036134 GCTGTTATTTGAGCACAGGTA pLKO.1 475 3UTR 100% 2.640 1.848 N ST3GAL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001739019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11315 pDONR223 100% 46.4% None (many diffs) n/a
2 ccsbBroad304_11315 pLX_304 0% 46.4% V5 (many diffs) n/a
3 TRCN0000471221 CTCTTGCTCCGCTGCCTTCCCTAG pLX_317 38.4% 46.4% V5 (many diffs) n/a
Download CSV