Transcript: Human XR_001740117.2

PREDICTED: Homo sapiens T cell activation inhibitor, mitochondrial (TCAIM), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCAIM (285343)
Length:
4591
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740117.2
NBCI Gene record:
TCAIM (285343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230758 AGATACCTTCGGGCAATATTT pLKO_005 4061 3UTR 100% 15.000 21.000 N TCAIM n/a
2 TRCN0000230756 TGTAGCCAGCTGCATAGTTTA pLKO_005 2061 3UTR 100% 13.200 18.480 N TCAIM n/a
3 TRCN0000230757 CCTCGAAGTTTGCGTGGTTTA pLKO_005 2415 3UTR 100% 10.800 15.120 N TCAIM n/a
4 TRCN0000166925 CCAGCATTTCTAGTATACAAA pLKO.1 2659 3UTR 100% 5.625 7.875 N TCAIM n/a
5 TRCN0000167932 CGTGCCTAACAACTGTACTTA pLKO.1 4353 3UTR 100% 5.625 7.875 N TCAIM n/a
6 TRCN0000218678 GCAAATCTCCAGTGGTTTATT pLKO_005 2517 3UTR 100% 15.000 10.500 N TCAIM n/a
7 TRCN0000167432 GCAGTCTGATAACCAGTTTAT pLKO.1 3602 3UTR 100% 13.200 9.240 N TCAIM n/a
8 TRCN0000218788 TCTCACATCCTGGTTAGATAA pLKO_005 1901 3UTR 100% 13.200 9.240 N TCAIM n/a
9 TRCN0000172718 GCCATGTGATGCTAGGAACAA pLKO.1 2173 3UTR 100% 4.950 3.465 N TCAIM n/a
10 TRCN0000168434 GCAGCCAGTAATTGACAGTTA pLKO.1 3466 3UTR 100% 4.950 2.970 N TCAIM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05395 pDONR223 100% 30.2% None (many diffs) n/a
2 ccsbBroad304_05395 pLX_304 0% 30.2% V5 (many diffs) n/a
3 TRCN0000481354 ACCCGTTTCTTCACCTAGCTGTCC pLX_317 35.1% 30.2% V5 (many diffs) n/a
Download CSV