Transcript: Human XR_001740179.2

PREDICTED: Homo sapiens ATR serine/threonine kinase (ATR), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATR (545)
Length:
8274
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740179.2
NBCI Gene record:
ATR (545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740179.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039614 CCGGATACTTACAGATGTAAA pLKO.1 215 3UTR 100% 13.200 18.480 N ATR n/a
2 TRCN0000332960 CCGGATACTTACAGATGTAAA pLKO_005 215 3UTR 100% 13.200 18.480 N ATR n/a
3 TRCN0000219647 CTCCGTGATGTTGCTTGATTT pLKO.1 281 3UTR 100% 13.200 18.480 N ATR n/a
4 TRCN0000332905 CTCCGTGATGTTGCTTGATTT pLKO_005 281 3UTR 100% 13.200 18.480 N ATR n/a
5 TRCN0000039615 GCCGCTAATCTTCTAACATTA pLKO.1 1929 3UTR 100% 13.200 18.480 N ATR n/a
6 TRCN0000195227 CCAACGAGGATATGAATATAT pLKO.1 5621 3UTR 100% 15.000 10.500 N ATR n/a
7 TRCN0000196538 GATGAACACATGGGATATTTA pLKO.1 636 3UTR 100% 15.000 10.500 N ATR n/a
8 TRCN0000344499 GATGAACACATGGGATATTTA pLKO_005 636 3UTR 100% 15.000 10.500 N ATR n/a
9 TRCN0000219648 TAATGGTTCTTACTCGTATTA pLKO.1 718 3UTR 100% 13.200 9.240 N ATR n/a
10 TRCN0000196852 GTAATGCATTTGGTATGAATC pLKO.1 8200 3UTR 100% 10.800 7.560 N ATR n/a
11 TRCN0000039613 CTGTGGTTGTATCTGTTCAAT pLKO.1 8220 3UTR 100% 5.625 3.938 N ATR n/a
12 TRCN0000332896 CTGTGGTTGTATCTGTTCAAT pLKO_005 8220 3UTR 100% 5.625 3.938 N ATR n/a
13 TRCN0000023913 CATTCCCTGATCCTACATCAT pLKO.1 7417 3UTR 100% 4.950 3.465 N Atr n/a
14 TRCN0000010301 GAATGGAGTAAACCAGTGAAA pLKO.1 7779 3UTR 100% 4.950 3.465 N ATR n/a
15 TRCN0000023912 GATTATTGAATGGGTGAACAA pLKO.1 7214 3UTR 100% 4.950 3.465 N Atr n/a
16 TRCN0000039616 GCCAAAGTATTTCTAGCCTAT pLKO.1 6582 3UTR 100% 4.050 2.835 N ATR n/a
17 TRCN0000039617 GCTGATTATTTACAACCCAAA pLKO.1 3447 3UTR 100% 4.050 2.835 N ATR n/a
18 TRCN0000010300 GAAAGAGGCTCCTACCAACGA pLKO.1 5607 3UTR 100% 2.640 1.848 N ATR n/a
19 TRCN0000010302 AATGCATTTGGTATGAATCTG pLKO.1 8202 3UTR 100% 0.000 0.000 N ATR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740179.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15334 pDONR223 100% 13.6% None (many diffs) n/a
2 ccsbBroad304_15334 pLX_304 0% 13.6% V5 (many diffs) n/a
3 TRCN0000470985 TCTAATACTCGTCGAGCTACCTAT pLX_317 34.4% 13.6% V5 (many diffs) n/a
Download CSV