Transcript: Human XR_001741973.1

PREDICTED: Homo sapiens adenylate cyclase 2 (ADCY2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY2 (108)
Length:
4653
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741973.1
NBCI Gene record:
ADCY2 (108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078332 CGTTCAAGTATTATGTGACTT pLKO.1 1810 3UTR 100% 4.950 3.960 N ADCY2 n/a
2 TRCN0000078330 GCGGGTAAACTATGAGCTGAA pLKO.1 2279 3UTR 100% 4.050 3.240 N ADCY2 n/a
3 TRCN0000078329 CGAGGAATAATCAACGTGAAA pLKO.1 3888 3UTR 100% 4.950 3.465 N ADCY2 n/a
4 TRCN0000078331 CGTTTCTAATAACAGTTCCAA pLKO.1 244 3UTR 100% 3.000 2.100 N ADCY2 n/a
5 TRCN0000110773 GCCATAAAGAAAGTGAGGGAT pLKO.1 1116 3UTR 100% 2.640 1.848 N Adcy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05772 pDONR223 100% 70.2% None (many diffs) n/a
2 ccsbBroad304_05772 pLX_304 0% 70.2% V5 (many diffs) n/a
3 TRCN0000475864 GGGGCCGCAGTTCGCTGGTCGATC pLX_317 11.3% 70.2% V5 (many diffs) n/a
4 TRCN0000489479 CGCGGCATTACAACGAGCCGGACG pLX_317 10.5% 70% V5 1_29del;2896_3591del;3984_4653delinsG n/a
5 TRCN0000488830 TACCGAGAAATACTCGCCGGACCT pLX_317 10.5% 70% V5 (not translated due to prior stop codon) 1_29del;2896_3591del;3984_4653del n/a
Download CSV