Transcript: Human XR_001742054.1

PREDICTED: Homo sapiens chromosome 5 open reading frame 51 (C5orf51), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C5orf51 (285636)
Length:
5415
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742054.1
NBCI Gene record:
C5orf51 (285636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133850 CTTTCATCATCGCTGTAACTA pLKO.1 1057 3UTR 100% 5.625 4.500 N C5orf51 n/a
2 TRCN0000135895 GCTATGATGTACAGTGGAGAA pLKO.1 821 3UTR 100% 4.050 3.240 N C5orf51 n/a
3 TRCN0000134640 GAGAACAAGCTAGTAGATGAA pLKO.1 286 3UTR 100% 4.950 3.465 N C5orf51 n/a
4 TRCN0000138679 GTGACATTCATCTGCTGGCTA pLKO.1 804 3UTR 100% 2.640 1.848 N C5orf51 n/a
5 TRCN0000137905 GCACTACATACAAGGAACCCT pLKO.1 924 3UTR 100% 0.750 0.525 N C5orf51 n/a
6 TRCN0000135166 CCCACACAGTTGGAGAATAAT pLKO.1 4020 3UTR 100% 15.000 7.500 Y C5orf51 n/a
7 TRCN0000135852 CCTCAGCTTTATGGGATACTA pLKO.1 2232 3UTR 100% 5.625 2.813 Y C5orf51 n/a
8 TRCN0000138149 GCTCCTTTGTTCTGGTCCTTT pLKO.1 3578 3UTR 100% 4.950 2.475 Y C5orf51 n/a
9 TRCN0000133779 CTAAATTACTGAGTGCAGGAA pLKO.1 635 3UTR 100% 2.640 1.848 N C5orf51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13554 pDONR223 100% 7.7% None (many diffs) n/a
2 ccsbBroad304_13554 pLX_304 0% 7.7% V5 (many diffs) n/a
3 TRCN0000480016 GTGACAGTGACTACGTGACCGTGG pLX_317 85.8% 7.7% V5 (many diffs) n/a
Download CSV