Transcript: Human XR_001743205.1

PREDICTED: Homo sapiens KH RNA binding domain containing, signal transduction associated 2 (KHDRBS2), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KHDRBS2 (202559)
Length:
1917
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743205.1
NBCI Gene record:
KHDRBS2 (202559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418509 GAGTGATGAGCTTCATGTATT pLKO_005 623 3UTR 100% 13.200 9.240 N KHDRBS2 n/a
2 TRCN0000422583 AGCTAAGGAAGAAGAACTAAG pLKO_005 572 3UTR 100% 10.800 7.560 N KHDRBS2 n/a
3 TRCN0000016895 CAGACCTATGAGACTTATGAT pLKO.1 1140 3UTR 100% 5.625 3.938 N KHDRBS2 n/a
4 TRCN0000016894 CCAGCCCATGAAGCTTATGAA pLKO.1 1026 3UTR 100% 5.625 3.938 N KHDRBS2 n/a
5 TRCN0000016896 GCTCTCAGAAAGAGTACTGAT pLKO.1 419 3UTR 100% 4.950 3.465 N KHDRBS2 n/a
6 TRCN0000016897 CGTCAGGAACAACTACGTGAA pLKO.1 744 3UTR 100% 4.050 2.835 N KHDRBS2 n/a
7 TRCN0000016893 CCTGACTACAATGATGAAATT pLKO.1 723 3UTR 100% 13.200 7.920 N KHDRBS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09825 pDONR223 100% 54.5% None (many diffs) n/a
2 ccsbBroad304_09825 pLX_304 0% 54.5% V5 (many diffs) n/a
3 TRCN0000468185 TTTTAGCTTTGTCAGTAAAATCGA pLX_317 39.6% 54.5% V5 (many diffs) n/a
Download CSV