Transcript: Human XR_001743356.2

PREDICTED: Homo sapiens triggering receptor expressed on myeloid cells like 4 (TREML4), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TREML4 (285852)
Length:
3253
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743356.2
NBCI Gene record:
TREML4 (285852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060681 GAATCTACAACGCTTCCGAAA pLKO.1 470 3UTR 100% 4.050 5.670 N TREML4 n/a
2 TRCN0000060678 TGACACAGAATGACTCGGGAT pLKO.1 437 3UTR 100% 2.160 1.728 N TREML4 n/a
3 TRCN0000428703 GCCCTAGAGTCCTATGAATTT pLKO_005 1356 3UTR 100% 13.200 9.240 N TREML4 n/a
4 TRCN0000060679 ACGTCTCCTATGTGGACTCTT pLKO.1 544 3UTR 100% 4.950 3.465 N TREML4 n/a
5 TRCN0000437050 GACAGCAGTGACGAGGTTTCT pLKO_005 922 3UTR 100% 4.950 3.465 N TREML4 n/a
6 TRCN0000060680 GTGCCTGAAGAACTTCACAAA pLKO.1 211 3UTR 100% 4.950 3.465 N TREML4 n/a
7 TRCN0000060682 CCTCCATCAATGGCTCTGAGA pLKO.1 623 3UTR 100% 2.640 1.848 N TREML4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05408 pDONR223 100% 18.4% None 1_141del;646_787del;884_3253del n/a
2 ccsbBroad304_05408 pLX_304 0% 18.4% V5 (not translated due to frame shift) 1_141del;646_787del;884_3253del n/a
3 TRCN0000480669 GGGGGCGTCATATAACAAACAATG pLX_317 67.5% 18.4% V5 (not translated due to frame shift) 1_141del;646_787del;884_3253del n/a
Download CSV